- Molecular Tool 'Coe>Vsx (Stolfi 2011)'
Molecular tool card for 'Coe>Vsx (Stolfi 2011)'
Name
Coe>Vsx (Stolfi 2011)
Targeted Gene
Family
Sequence-based
Type
overexpression_construct
Supplier
Comment
The 2.6 kb genomic DNA segment located upstream of Coe (REG00001266) directs expression of Vsx (C11.689) in all of the differentiating visceral ganglion neural precursors. Vsx protein-coding cDNA sequence was amplified by RT-PCR. First-strand cDNA synthesis was performed off mixed-stage embryo whole mRNA preparations using oligo-dT primer. For PCR, the following primers were used (left to right=5′ to 3′): Vsx cDNA N F, ATGATTACGTCACTCAAAAGAAG; Vsx cDNA C R, TCATTCTTCCTTCGAGCATTG; Vsx gene prediction models were incomplete, and thus the 5′ and 3′ ends were determined by SMART RACE cDNA amplification kit (Clontech), using gene-specific primers Vsx GSP1 (TCTGCCATAACGCTACTCTTGCCCCAAC) and Vsx GSP2 (TCTTGCTCATTACCCGGATGCAGAAACG) for 5′-RACE and 3′-RACE, respectively. This revealed a 1563 bp sequence coding for an open reading frame of 521 amino acids. Outside the highly conserved homeodomain, this ORF showed stretches that were similar to the Ciona savigny ortholog of Vsx, but not to vertebrate or non-chordate orthologs.
Regulation
Gain of function
