Login
Help

GENE CARD

Submit your Data

EST count

27 results

Library Name Percentage Expression
Ciona intestinalis whole animal Ciona intestinalis whole animal 0 clone(s) / 0
Nori Satoh unpublished cDNA library Nori Satoh unpublished cDNA library 0 clone(s) / 5,577
Nori Satoh unpublished cDNA library, young adult Nori Satoh unpublished cDNA library, young adult 0 clone(s) / 31,366
Nori Satoh unpublished cDNA library, cleavage stage embryo Nori Satoh unpublished cDNA library, cleavage stage embryo 3 clone(s) / 15,579
Nori Satoh unpublished cDNA library, egg Nori Satoh unpublished cDNA library, egg 0 clone(s) / 31,100
Nori Satoh unpublished cDNA library, larva Nori Satoh unpublished cDNA library, larva 0 clone(s) / 26,704
Nori Satoh unpublished cDNA library, tailbud embryo Nori Satoh unpublished cDNA library, tailbud embryo 2 clone(s) / 26,680
directional larval cDNA library directional larval cDNA library 0 clone(s) / 39
Ascidian hemocytes cDNA library Ascidian hemocytes cDNA library 0 clone(s) / 0
K. Inaba unpublished cDNA library, testis K. Inaba unpublished cDNA library, testis 0 clone(s) / 5,468
Stratagene UniZAP whole-larva library Stratagene UniZAP whole-larva library 0 clone(s) / 0
Ciona intestinalis larva Ciona intestinalis larva 0 clone(s) / 0
Nori Satoh unpublished cDNA library, blood cells Nori Satoh unpublished cDNA library, blood cells 0 clone(s) / 29,579
Nori Satoh unpublished cDNA library, endostyle Nori Satoh unpublished cDNA library, endostyle 0 clone(s) / 2,556
Nori Satoh unpublished cDNA library, cleaving embryo Nori Satoh unpublished cDNA library, cleaving embryo 0 clone(s) / 16,939
Nori Satoh unpublished cDNA library, gastrula and neurula Nori Satoh unpublished cDNA library, gastrula and neurula 1 clone(s) / 25,258
Nori Satoh unpublished cDNA library, gonad Nori Satoh unpublished cDNA library, gonad 0 clone(s) / 16,936
Nori Satoh unpublished cDNA library, neural complex Nori Satoh unpublished cDNA library, neural complex 0 clone(s) / 10,463
Nori Satoh unpublished cDNA library, heart Nori Satoh unpublished cDNA library, heart 0 clone(s) / 13,243
Yutaka Satou unpublished cDNA library, adult digestive gland Yutaka Satou unpublished cDNA library, adult digestive gland 0 clone(s) / 17,765
Yutaka Satou unpublished cDNA library, embryo whole animal Yutaka Satou unpublished cDNA library, embryo whole animal 1 clone(s) / 17,872
Yutaka Satou unpublished cDNA library, mature adult whole animal Yutaka Satou unpublished cDNA library, mature adult whole animal 0 clone(s) / 107,314
Nori Satoh unpublished cDNA library, juvenile whole animal Nori Satoh unpublished cDNA library, juvenile whole animal 1 clone(s) / 24,372
Nori Satoh unpublished cDNA library, mature adult whole animal Nori Satoh unpublished cDNA library, mature adult whole animal 0 clone(s) / 17,126
Ciona intestinalis whole animal stage3 juvenile Ciona intestinalis whole animal stage3 juvenile 0 clone(s) / 3,798
Yutaka Satou unpublished library (cicx) Yutaka Satou unpublished library (cicx) 0 clone(s) / 2,031
Gateway compatible cien cDNA library, Ciona intestinalis mixed embryonic stages (Egg to Neurula) Gateway compatible cien cDNA library, Ciona intestinalis mixed embryonic stages (Egg to Neurula) 4 clone(s) / 188,431

RNA-Seq transcriptome profiles (by Experiment)

3 results

OVERVIEW

   Expression profile summary from all experiments in WT and mutant conditions:
FPKM & RPKM

Click here to see the RNA-Seq Pipeline Protocol.
You can show/hide lines in the charts by clicking on it in the legend part.
You can see more details by clicking on a point and then, on the link which will appear.

Be careful, FPKM & RPKM does not permit you to compare a gene across different conditions or experiments.

Download FPKM & RPKM data

OVERVIEW

   Expression profile summary from all experiments in WT and mutant conditions:
Relative Log Expression RLE

Be careful, RLE and 2RLE does not permit you to compare a gene across different experiments.

Download RLE Relative Log Expression data

RNA-Seq Experiment n°34135

Read more…

Oocytes of a single individual of Ciona intestinalis (Roscoff, France) were fertilized by a mixture of sperm of two individuals and development was followed microscopically. Embryos were snapfrozen in liquid nitrogen at the appropriate stage and kept at -80°C. Samples at stage 0, 8, 12, 15, 21, 26 were collected from the same fertilzation, while sample from stage 11 was independently collected from a different individual. Total RNA was prepared with the RNA II kit of Magerey Nagel and the quality was checked with the Bioanalyzer, all samples had a RIN value of higher than 9. Strand specific libraries were constructed and the sequencing (50PE) was performed with Illumina HiSeq 2000 technology (BGI, Hong Kong, China). Reads were aligned onto C.robusta genome and considered to reflect the expression of the C.robusta orthologous genes.

Assay platform Illumina HiSeq 2000
Layout Paired-end
Stranded Yes
Read length 49
Normalized data types
  • FPKM
  • RLE
Wild type - Replica 1
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 0 (Unfertilized egg)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 11 (early gastrula)
C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)
C. robusta formely Ciona int. type A, Stage 15 (mid neurula)
C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)
C. robusta formely Ciona int. type A, Stage 26 (hatching larva)
Wild type - Replica 2
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 0 (Unfertilized egg)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 11 (early gastrula)
C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)
C. robusta formely Ciona int. type A, Stage 15 (mid neurula)
C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)
C. robusta formely Ciona int. type A, Stage 26 (hatching larva)

RNA-Seq Experiment n°34138

Read more…

Ciona robusta adults were obtained from the National Bio-Resource Project for Ciona (NBRP, Japan). 50 unperturbed and Foxd-morphant embryos were collected at the 32-, 64-, and 112-cell stages. RNA was extracted using a Dynabeads mRNA DIRECT Purification Kit (Thermo Fischer Scientific) and libraries were made with an Ion Total RNA-Seq kit ver 2 (Thermo Fischer Scientific). The libraries were sequenced with an Ion PGM instrument (Thermo Fischer Scientific).

Assay platform Ion Torrent PGM
Layout Single-end
Stranded Yes
Read length 20-365
Normalized data types
  • RPKM
Wild type
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 10 (112-cell)
Mutant
Deregulated molecule(s) KH2012:KH.C8.890 -
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 10 (112-cell)

RNA-Seq Experiment n°34139

Read more…

The purpose of this project is to identify genes positively and negatively regulated by signaling molecules that belongs to the TGFbeta superfamily.

Assay platform Illumina HiSeq 2500
Layout Single-end
Stranded Yes
Read length 101
Normalized data types
  • RPKM
Wild type
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 13 (late gastrula)
Mutant 1
Deregulated molecule(s) KH2012:KH.C4.125 -
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 13 (late gastrula)
Mutant 2
Deregulated molecule(s) KH2012:KH.C2.573 -
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

In Situ Experiment Data

192 results

Experiment data ( results)

C. robusta formely Ciona int. type A, Stage 1 (One cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : No signal was detected

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 4 (8-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : No distinct zygotic signal was detected

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 5a (early 16-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : No distinct zygotic signal was detected

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)

Read more…

Vegetal view (dorsal is up) of a 32-cell stage wild type embryo stained for Ci-Bra mRNA by in situ hybridization.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : No distinct zygotic signal was detected

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a WT Ciona robusta late 32-cell stage embryo probed for brachyury expression.
No expression is observed.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a WT Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected with a control MO.
Brachyury expression is observed in the notochord progenitors A7.3 and A7.7 blastomers (black arrowheads).
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.a, Prdm1-r.b and Hes.a.
Brachyury expression is observed in the notochord progenitors A7.3 and A7.7 (black arrowheads), and in a7.9, a7.10 and a7.13 blastomers (cyan arrowheads).
Original annotation: Brachyury was expressed ectopically in the presumptive brain/palp cells (cyan arrowheads) of Prdm1- r.a/b/Hes.a morphants from the 64-cell stage.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) a7.10 cell pair - a7.13 cell pair - A7.3 cell pair - A7.7 cell pair - a7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.a and Prdm1-r.b.
Brachyury expression is observed in the notochord progenitors A7.3 and A7.7 blastomers (black arrowheads), and in a7.9 pair (cyan arrowhead).
Original annotation: A small fraction of Prdm1-r.a/b double morphants expressed Brachyury weakly in the presumptive brain/palp cells.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair - a7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a Ciona robusta 64-cell stage embryo probed for Brachyury expression, injected with morpholino oligos against Prdm1-r.a, Prdm1-r.b and Hes.a, and treated with DMSO (control for U0126 treatment).
Brachyury expression is observed in notochord progenitors (A7.3 and A7.7, black arrowheads), and in palps/brain progenitors (a7.9, a7.10 and a7.13, cyan arrowheads).
Original annotation: Brachyury was expressed ectopically in the presumptive brain/palp cells of Prdm1- r.a/b/Hes.a morphants at the 64-cell stage.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) a7.10 cell pair - a7.13 cell pair - A7.3 cell pair - A7.7 cell pair - a7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a Ciona robusta 64-cell stage embryo probed for Brachyury expression, injected with morpholino oligos against Prdm1-r.a, Prdm1-r.b and Hes.a, and treated with The MEK inhibitor U0126 from the 44-cell stage.
No Brachyury expression is observed.
Original annotation: Prdm1-r.a/b/Hes.a morphants treated with U0126 (which inhibits the Fgf signaling pathway) from the 44-cell stage did not express Brachyury.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected into the pair of anterior animal cells at the 8-cell stage with morpholino oligos against Prdm1-r.a, Prdm1-r.b, Hes.a and a control MO.
Brachyury expression is observed in notochord progenitors (A7.3 and A7.7, black arrowheads) and in palps/brain precursors (a7.9, a7.10 and a7.13, cyan arrowheads).
Original annotation: Brachyury was expressed ectopically in the presumptive brain/palp cells of Prdm1- r.a/b/Hes.a morphants at the 64-cell stage.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) a7.10 - a7.13 cell pair - A7.3 cell pair - A7.7 cell pair - a7.9 -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected into the pair of anterior animal cells at the 8-cell stage with morpholino oligos against Prdm1-r.a, Prdm1-r.b, Hes.a and Foxa.a.
Brachyury expression is observed in the notochord progenitors (A7.3 and A7.9 blastomers, black arrowheads).
Original annotation: Ectopic Brachyury expression was lost when we injected Foxa.a MO concomitantly with Prdm1-r.a, Prdm1-r.band Hes.a MOs.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view (animal to the top) of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected into the pair of anterior animal cells at the 8-cell stage with morpholino oligos against Prdm1-r.a, Prdm1-r.b, Hes.a and Zic-r.b.
Brachyury expression is observed in the notochord progenitors (A7.3 and A7.9 blastomers, black arrowheads).
Original annotation: Ectopic Brachyury expression was lost when we injected Zic-r.b MO concomitantly with Prdm1-r.a, Prdm1-r.band Hes.a MOs.
n, number of embryos examined. % : Percentages of embryos with ectopic expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a WT Ciona robusta 64-cell stage embryo probed for Brachyury expression.
Brachyury is expressed in A7.3 and A7.7 blastomers.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Animal view of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected with morpholinos against Foxd.
Brachyury is expressed in the a-lineage.
Original comment: Foxd mRNA injection, was able to convert a-line cells to a mesendoderm state. Ectopic expression of Bra (a marker of notochord precursors) in a-line cells was induced at the 64-cell stage.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) a line -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Animal view of a Ciona robusta 64-cell stage embryo probed for Brachyury expression, injected with morpholinos against Foxd and treated with U0126 from the 16-cell stage.
Brachyury expression is lost.
Original comment: When Foxd mRNA-injected embryos were treated with U0126, Bra expression was completely suppressed.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Animal view of a Ciona robusta 64-cell stage embryo probed for Brachyury expression, injected with morpholinos against Foxd and treated with BIO from the 16-cell stage.
Brachyury expression is lost.
Original comment: When Foxd-mRNA injected embryos were treated from the late 16-cell stage with BIO in order to mimic the second input of nb-catenin activation Bra was repressed.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a WT Ciona robusta 64-cell stage embryo probed for Brachyury expression.
Brachyury is expressed in B7.3, A7.3 and A7.7 blastomers.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected with morpholinos against beta-catenin.
Brachyury expression is lost.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a Ciona robusta 64-cell stage embryo probed for Brachyury expression and injected with Foxd mRNA and morpholinos against beta-catenin.
Brachyury is expressed throughout the A-lineage.
Original comment: Injection of Foxd mRNA was able to rescue expression of NN-lineage gene (Neural Notochord) in b-catenin-MO embryos.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair - A line -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a Ciona robusta 64-cell stage embryo probed for Brachyury expression, injected with Foxd mRNA and morpholinos against beta-catenin, and treated with U0126 from the 16-cell stage.
Brachyury expression is lost.
Original comment: Injection of Foxd mRNA is not able to rescue Bra expression in b-catenin-MO embryos when FGF-signalling pathway is inhibited.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Anterior view, animal pole up of a WT Ciona robusta 32-cell stage embryo probed for Brachyury expression.
Brachyury is expressed in A7.3, B7.3 and A7.7 blastomer pairs.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Anterior view, animal up, of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Anterior view, animal up, of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Anterior view, animal up, of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Anterior view, animal up, of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

Vegetal view of a Ciona robusta 32-cell stage embryo probed for Brachyury expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Brachyury is expressed in A7.3, A7.7 and B7.3 cell pairs and ectopically in A7.8 and A7.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Brachyury. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.4 cell pair - A7.7 cell pair - A7.8 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

64-cell stage wild type embryo probed for Ci-brachyury expression.

Ci-Bra was expressed in the notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

64-cell stage embryo probed for Ci-brachyury expression following the injection of Ci-Rga-MO.

Ci-Bra expression was lost (in 64% of embryos) or reduced (27% of embryos) in the notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage wild type probed for Ci-brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : A7.3, A7.7

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage embryo probed for Ci-Bra expression. Expression was detected in the both early and late markers of notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage probed for Ci-Bra expression. Expression was downregulated using SB431542 inhibitor. This picture shows that Ci-Bra expression in the notochord remained expressed after treatment with SB431542.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64 cell stage embryo probed for Ci-Bra expression. Staining is observed in the notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64 cell stage embryo probed for Ci-Bra expression following egg micro-injection of a FGF9 MO.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage wild type embryo stained for Ci-Bra mRNA in situ hybridization.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage embryo stained with bra expression. Expression observed in A7.3 and A7.7 cell pairs.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage embryo stained with bra expression after BIO treatment at the 8-cell stage. No expression in the entire embryo.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a late 32-cell stage embryo marked with bra after TCF∆C treatment at the 16-cell stage in A5.1 cell. The red arrow points the NN cells and the blue arrow the E cells. The green dashed line marks the region containing the cells from the A5.1 cell lineage.
Original annotation: Expression in A7.2 and A7.1 cell (E cells) as well as in A7.3 and A7.7 cell pairs (NN cells).
(+HD photo)

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage embryo stained with bra expression after TCF∆C treatment at the 16-cell stage in A5.3 cell and BIO treatment at the late 8-cell stage.
Original annotation: Expression of bra in four animal cells.
Aniseed annotation: Expression is observed in a7.12, a7.13, a7.14 and a7.15 cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) a7.12 cell pair - a7.13 cell pair - a7.14 cell pair - a7.15 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a WT Ciona robusta 64-cell stage embryo probed for brachyury expression.
Expression is observed in A7.3, A7.7 and B7.7 blastomere pairs.
In schematic representation of gene expression, notochord precursors are shown in red and nerve cord precursors in blue. Blastomeres with gene expression are marked by dots.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64 cell stage embryo probed for ci-bra expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64- cell stage embryo probed for Ci-Bra expression following Ci-ephrin-Ad RNA injection . Consistent with the idea that ephrin-Eph signals inhibit notochord fates, expression of Ci-Bra was blocked. Average of cells positive : 0.2 for this marker, total number of samples analysed : 15.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage embryo probed for Ci-Bra expression following following ephrinAd-MO injection. Ci-Bra was expressed ectopically in the neural precursors. Average of cells positive : 6.7 for this marker, total number of samples analysed : 28.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.2 cell pair - A7.3 cell pair - A7.5 cell pair - A7.7 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view anterior is up of 64 cell-stage embryos electroporated with the Brachyury cis-regulatory region (3.5 Kb upstream the TATA box of brachyury gene ci0100134430). The reporter reproduced the spatial expression pattern of endogenous Ci-Bra at the 64-cell stage. Some mosaicism is apparent on the pictures.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair - B7.3 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of 64 cell-stage embryos electroporated with the Brachyury cis-regulatory region (483bp upstream the TSS of brachyury gene ci0100134430). The 483bp region possesses minimal notochord enhancer activity.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A7.3 cell pair - A7.7 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Conversion to Aniseed format of Ghost database entry from Fujiwara S et al., Mech Dev. 2002; 112Gene name: 115-127. Original annotation: . Expression pattern: Notochord

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (dorsal is up) of a 110-cell stage wild type embryo stained for Ci-Bra mRNA by in situ hybridization.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Original annotation :
Gene name :Brachyury.
Expression pattern : A8.5, A8.6, A8.13, A8.14, B8.6

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Brachyury expression following egg micro-injection of a FoxD-a/b MO. Brachyury was down-regulated in A-line and B-line notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cells stage embryo probed for Brachyury expression following egg micro-injection of a FGF9/16/20 MO. Brachyury was down-regulated in A-line and B-line notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Brachyury expression following egg micro-injection of a FoxA-a MO. Brachyury was down-regulated in A-line and B-line notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage wild type embryo probed for Ci-Bra expression. This picture shows expression in the primary and secondary notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra following inhibition of Nodal signalling with SB431542. Treatment with SB431542 selectively abolished expression of Ci-Bra in the secondary notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression. Nodal signalling was inhibited by injection of Nodal-Mo. This picture shows expression in the primary notochord precursors but the injection causes a severe downregulation of Ci-Bra expression in B8.6.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage wild type probed for Ci-brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : A8.5, A8.6, A8.13, A8.14, B8.6

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal pole view of a 110-cell stage wild type embryo probed for Ci-Bra expression. This picture shows expression in the primary and secondary notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal pole view of a 110-cell stage embryo probed for Ci-Bra expression in which Nodal signalling has been blocked with SB431542. This picture shows that Ci-Bra expression in the secondary notochord precursor was severaly downregulated when embryos were placed in SB431542 at 16-cell stage.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which Delta2 ligand has been inhibited with an antisense morpholino oligonucleotide. The expression of Ci-Bra is abolished in the secondary notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal pole view of a 110-cell stage embryo probed for Ci-Bra expression in which Nodal signalling has been blocked with SB431542. This picture shows that Ci-Bra expression in the secondary notochord precursors was severaly downregulated when embryos were placed in SB431542 at 32-cell stage.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal pole view of a 110-cell stage embryo probed for Ci-Bra expression in which Nodal signalling has been blocked with SB431542. This picture shows that Ci-Bra expression is independant to Nodal signalling when embryos are treated with SB431542 at 64-cell stage.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal pole view of a 110-cell stage embryo probed for Ci-Bra expression in which Nodal signalling has been blocked with SB431542. This picture shows that Ci-Bra expression is independant to Nodal signalling when embryos are treated with SB431542 at 110-cell stage.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.6 cell pair - A8.7 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which Nodal signalling has been blocked with SB431542. This picture shows that Ci-Bra expression is independant to Nodal signalling when embryos are treated with SB431542 at 76-cell stage.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which gamma-secretase has been inhibited with a pharmacological reagent DAPT. Treatement with DAPT specificaly inhibited Ci-bra expression in the secondary notochord precursor.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which Delta2 ligand has been inhibited using a version of Ci-Delta2 lacking the intracellular domain (dnDel2). Treatement with dnDel2 selectively abolished expression of Ci-Bra in the secondary notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which Delta/Notch signal transduction has been blocked with Su(H)DBM mRNA. Treatment with Su(H)DBM selectively abolished expression of Ci-Bra in the secondary notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110 cell stage embryo probed for Ci-Bra expression. Staining is observed in the notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 64 cell stage embryo probed for Ci-Bra expression following egg micro-injection of a FGF9 MO.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

110-cell stage wild type embryo probed for Ci-Bra expression. GFP mRNA was injected as a control in A4.1 right hand side.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which Nodal signalling has been blocked with tALK4/5/7 mRNA. mRNA were injected into A4.1 on the right side at 8-cell stage and then analysed for Ci-Bra expression at 110-cell stage (left side is used as a control). There is no expression on B8.6 cell on the right side.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which Delta/Notch signal transduction has been blocked with Su(H)DBM mRNA. mRNA was injected in A4.1 blastomere on the right side of the embryo and then analysed for Ci-Bra expression at 110-cell stage (left side is used as a control). Expression seems to be the same in the right and left sides.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

110-cell stage wild type embryo probed for Ci-Bra expression. GFP mRNA was injected as a control in B4.1 on the right hand side.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-Bra expression in which Nodal signalling has been blocked with tALK4/5/7 mRNA. mRNA were injected into B4.1 on the right side at 8-cell stage and then analysed for Ci-Bra expression at 110-cell stage (left side is used as a control). Expression 0n the right side in B8.6 is weaker as in the control side.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal pole view of 110-cell stage embryo probed for Ci-Bra expression in which Delta/Notch signal transduction has been blocked with Su(H)DBM mRNA. mRNA was injected in B4.1 blastomere on the right side of the embryo and then analysed for Ci-Bra expression at 110-cell stage (left side is used as a control). There is no expression in B8.6 on the right side compared to the control side.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110 cell stage embryo probed for Ci-Bra expression. Staining is observed in the notochord precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110 cell stage embryo probed for Ci-Bra expression. Embryos were traited with a pharmacological inhibitor U0126 from the 32 cell stage. Expression is lost.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110 cell stage embryo probed for Ci-Bra expression. Embryos were traited with a pharmacological inhibitor U0126 from the 32 cell stage. A majority of embryos expressed a reduced level of Ci-Bra in the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.6 cell pair - A8.7 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110 cell stage embryo probed for Ci-Bra expression. Embryos were traited with a pharmacological inhibitor U0126 from the 32 cell stage. A majority of embryos expressed a reduced level of Ci-Bra in the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.6 cell pair - A8.7 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110 cell stage embryo probed for Ci-bra expression. Staining is detected in A8.5, A8.6, A8.13, A8.14 and B8.6 cell pairs.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo stained for Ci-Bra mRNA by in situ hybridization after suppression of Ci-ZicL function with specific morpholino. This suppression abolished endogeneous Ci-Bra activation following the loss of notochord differentiation.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo showing Brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo injected with ephrin-Ad MO and probed for Brachyury.

Original annotation:
Brachyury expression is expanded to the A-line neural tissues.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.15 cell pair - A8.16 cell pair - A8.5 cell pair - A8.6 cell pair - A8.7 cell pair - A8.8 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for brachyury expression following injection of ZicL::torso-FGFR construct. The constitutively active form of FGFR (torso-FGFR) is expressed under the ZicL enhancer.

Original annotation: Brachyury is ectopically expressed in A-line blastomeres, in muscle and in mesenchyme.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.15 cell pair - A8.16 cell pair - A8.5 cell pair - A8.6 cell pair - A8.7 cell pair - A8.8 cell pair - B7.5 cell pair - B7.7 cell pair - B8.16 cell pair - B8.5 cell pair - B8.6 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal pole view of a 110-cell stage wild type embryo probed for Ci-Bra expression. Ablation of A6.3 on the left-hand side leads to the loss of Ci-Bra expression in the secondary notochord precursor on the ablated side.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal ple view of a 110-cell stage wild type embryo probed for Ci-Bra expresion. Ablation of b5.3 on the right hand side leads to an inhibition of Ci-Bra expression in the secondary notochord precursor on the ablated side.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of Brachyury in WT stage 10 embryos

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of Brachyury in stage 10 embryos microinjected with dnEph3 RNA at the egg stage. There may be expression, not annotated, in additional B line cells. The bar graph provides a quantification of the experiment.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.15 cell pair - A8.16 cell pair - A8.5 cell pair - A8.6 cell pair - A8.7 cell pair - A8.8 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a WT Ciona robusta 112-cell stage embryo probed for brachyury expression.
Expression is observed in A8.5, A8.6, A8.13, A8.14 and B8.6 blastomere pairs.
In schematic representation of gene expression, notochord precursors are shown in red and nerve cord precursors in blue. Blastomeres with gene expression are marked by dots.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of 110-cell stage embryo stained for Brachyury mRNA (AV955122).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of Brachyury in an uninjected sibbling embryo. No picture available in the article.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of 110-cell stage embryo injected with Ets1/2-MO (Ets1/2 morpholino: CATGTTGGTCTACCATGTTTCTGAA) and stained for Brachyury mRNA (AV955122). Penetrance of the phenotype was 100%. The control picture shows expression of Brachyury in an uninjected sibbling embryo.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of 110-cell stage embryo injected with GATAa-MO morpholino (GGGTTAGGCATATACATTCTTTGGA) and stained for Brachyury mRNA (AV955122). GATAa-MO injected embryo does not repress Brachyury expression pattern. The control picture shows the wild-type expression of brachyury in a sibbling uninjected embryo. Expression in the secondary notochord lineage is very faint.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of a 110-cell stage embryo probed for Ci-bra expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of a notochord-marker, Ci-Bra, analysed at the 110-cell stage by in situ hybridisation in partial embryo derived from isolated cells (A6.2 and A6.4 blastomeres).

Original annotation : according to the cell lineage, each of A6.2 and A6.4 blastomeres should generate two notochord and two neural precursors at the 110-cell stage. When isolated shortly before their division (at the late 32-cell stage), these cells showed equivalent fate attribution, expressing Ci-Bra in an average of 2.0. By contrast, when they were isolated early in the cell cycle (at the 24-cell stage), the resultant partial embryos had an average of 3.2 cells positive for Ci-Bra.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of a notochord-marker, Ci-Bra, analysed at the 110-cell stage by in situ hybridisation in partial embryo derived from isolated cells (A6.2 and A6.4 blastomeres).

Original annotation : According to the cell lineage, each of A6.2 and A6.4 blastomeres should generate two notochord and two neural precursors at the 110-cell stage. When isolated shortly before their division (at the late 32-cell stage), these cells showed equivalent fate attribution, expressing Ci-Bra in an average of 2.0. By contrast, when they were isolated early in the cell cycle (at the 24-cell stage), the resultant partial embryos had an average of 3.2 cells positive for Ci-Bra.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.15 cell pair - A8.16 cell pair - A8.5 cell pair - A8.6 cell pair - A8.7 cell pair - A8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of Ci-Bra, analysed at the 110-cell stage by in situ hybridisation in partial embryo derived from isolated cells (A6.2 and A6.4 blastomeres).

Original annotation : according to the cell lineage, each of A6.2 and A6.4 blastomeres should generate two notochord and two neural precursors at the 110-cell stage. When isolated at the late 32-cell stage, these cells showed equivalent fate attribution, expressing Ci-Bra in an average of 1.6 cells (42 samples analyzed).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of Ci-Bra, analysed at the 110-cell stage by in situ hybridisation in partial embryo derived from isolated cells (A6.2 and A6.4 blastomeres) following injection of ephrinAd-MO.

Original annotation : according to the cell lineage, each of A6.2 and A6.4 blastomeres should generate two notochord and two neural precursors at the 110-cell stage. When isolated at the late 32-cell stage and after injection of ephrinAd-MO, the resultant partial embryos produce more notochord cells (2.9 cells) at the expense of neural cells (0.5 cells).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of a notochord-marker, Ci-Bra analysed at the 110-cell stage by in situ hybridisation in partial embryo derived from isolated cells (A4.1 blastomeres).

Original annotation: The number of cells expressing Ci-Bra in the A4.1-derived partial embryos was significantly higher than that predicted from the cell lineage (6.4 versus 4).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A line -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Expression of a notochord-marker, Ci-Bra, analysed at the 110-cell stage by in situ hybridisation in partial embryo derived from co-isolated cells (A4.1 and a4.2 blastomeres).

Original annotation : the average number of Ci-Bra positive cells at the equivalent of the 110-cell stage was reduced to 3.2 cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of 110 cell-stage embryos electroporated with a Ci-Brachyury cis-regulatory region (from 3.5 Kb upstream the TATA box of brachyury gene ci0100134430 to the 18th codon) driving LacZ, and processed by ISH. The reporter reproduces the notochord-specific spatial expression pattern of endogenous Ci-Bra at the 110-cell stage.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of 110-cell stage embryos electroporated with the Brachyury cis-regulatory region (3.5 Kb upstream the TSS of brachyury gene ci0100134430) that is mutated in the two potential ZicL DNA binding motifs (B1: CACAGCTGG and B2: CCAGCTGTG). Mutation in both ZicL DNA-binding motifs abolished completely reporter expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of 110 cell-stage Ciona intestinalis embryos electroporated in fertilized eggs with a short Brachyury cis-regulatory region (starting 483 bp upstream the TATA box of brachyury gene ci0100134430 and extending up the first aa). This construct has a weaked notochord enhancer activity than the sequence starting -3.5kb upstream of the TATA box, shown here as control. Expression in B-line notochord is unclear.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of 110 cell-stage Ciona intestinalis embryos injected with a Brachyury cis-regulatory region (483 bp upstream the TATA box of brachyury gene ci0100134430, driving LacZ) mutated for the two ZicL DNA-binding motifs. The mutations abolish reporter expression. The control picture shows the expression of the wt construct in sibbling embryos.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Embryos electroporated with a construct (ebra290 construct in the paper) containing the entire Ci-fog cis regulatory region from -290bp to the ATG. The Ci-bra enhancer covering position -470 to -62 was inserted upstream of pfog. Electroporation of this construct led to robust notochord expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal (left) and lateral (right) views of a Ciona robusta early gastrula embryo probed for Brachyury expression and injected with a control MO.
Brachyury expression is observed in the notochord progenitors (A8.13, A8.14, A8.6, A8.5 and B8.6 blastomers).
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal (left) and lateral (right) views of a Ciona robusta early gastrula embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.a, Prdm1-r.b and Hes.a.
Brachyury expression is observed in the notochord progenitors (A8.13, A8.14, A8.6, A8.5 and B8.6 blastomers) and in a-lineage brain/palps precursors (cyan arrowheads).
Original annotation: We found that Brachyury was expressed ectopically in the presumptive brain/palp cells of Prdm1- r.a/b/Hes.a morphants from the 64-cell to the gastrula stage.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.19 cell pair - a8.25 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal (left) and lateral (right) views of a Ciona robusta early gastrula embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.a and Prdm1-r.b.
Brachyury expression is observed in the notochord progenitors (A8.13, A8.14, A8.6, A8.5 and B8.6 blastomers) and in a-lineage brain/palps precursors (cyan arrowheads).
Original annotation: A small fraction of Prdm1-r.a/b double morphants also expressed Brachyury weakly in the presumptive brain/palp cells.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.19 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal (left) and lateral (right) views of a Ciona robusta early gastrula embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.a.
Brachyury expression is observed in the notochord progenitors (A8.13, A8.14, A8.6, A8.5 and B8.6 blastomers).
Original annotation: Single morphants of either Prdm1-r.a, Prdm1-r.b or Hes.a did not express Brachyury ectopically.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal (left) and lateral (right) views of a Ciona robusta early gastrula embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.b.
Brachyury expression is observed in the notochord progenitors (A8.13, A8.14, A8.6, A8.5 and B8.6 blastomers).
Original annotation: Single morphants of either Prdm1-r.a, Prdm1-r.b or Hes.a did not express Brachyury ectopically.
n, number of embryos examined. % : Percentages of embryos with ectopic expression

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal (left) and lateral (right) views of a Ciona robusta early gastrula embryo probed for Brachyury expression and injected with morpholino oligos against Hes.a.
Brachyury expression is observed in the notochord progenitors (A8.13, A8.14, A8.6, A8.5 and B8.6 blastomers).
Original annotation: Single morphants of either Prdm1-r.a, Prdm1-r.b or Hes.a did not express Brachyury ectopically.
n, number of embryos examined. % : Percentages of embryos with ectopic expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal view of a WT Ciona robusta early gastrula stage embryo probed for Brachyury expression.
Brachyury, a notochord marker, is expressed in A8.5, A8.6, A8.13, A8.14 and B8.6 blastomere pairs.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal view of a Ciona robusta early gastrula stage embryo probed for Brachyury expression and injected with morpholino oligos against Eph-1.
Brachyury, a notochord marker, is expressed in A8.5, A8.6, A8.13, A8.14 and B8.6 blastomere pairs.
Original comment: Mesoderm marker gene expression was not affected by Eph1 morpholino injection.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal view of an early gastrula embryo stained with bra expression. Red arrow points to the notochord (NN cell originally). Expression observed in A8.5, A8.6, A8.13, A8.14 and B8.6 cell pairs.
(+HD photo)

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) A8.13 cell pair - A8.14 cell pair - A8.5 cell pair - A8.6 cell pair - B8.6 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal view of an early gastrula embryo stained with bra expression after BIO treatment at the late 16-cell stage. No expression in the entire embryo.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)

Read more…

Neural plate view of a Mid gastrula stage wild type probed for Ci-brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Dorsal view of a Ciona robusta late gastrula embryo probed for Brachyury expression and injected with a control MO.
Brachyury expression is observed in the notochord.
n, number of embryos examined. % : Percentages of embryos with ectopic expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Dorsal view of a Ciona robusta late gastrula embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.a, Prdm1-r.b and Hes.a.
Brachyury expression is observed in the notochord and in a-lineage brain/palps precursors (cyan arrowheads).
Original annotation: We found that Brachyury was expressed ectopically in the presumptive brain/palp cells of Prdm1- r.a/b/Hes.a morphants from the 64-cell to the gastrula stage.
n, number of embryos examined. % : Percentages of embryos with ectopic expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - row III neural plate - row IV neural plate - row V neural plate -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Dorsal view of a Ciona robusta late gastrula embryo probed for Brachyury expression and injected with morpholino oligos against Prdm1-r.a and Prdm1-r.b.
Brachyury expression is observed in the notochord.
Original annotation: A small fraction of Prdm1-r.a/b double morphants also expressed Brachyury weakly in the presumptive brain/palp cells.
n, number of embryos examined. % : Percentages of embryos with ectopic expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Conversion to Aniseed format of Ghost database entry from Fujiwara S et al., Mech Dev. 2002; 112Gene name: 115-127. Original annotation: . Expression pattern: Notochord

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Neural plate view of a Late gastrula stage wild type probed for Ci-brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : notochord

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal view of a late gastrula cell stage embryo probed for Ci-Bra expression. Staining is observed in the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal view of a late gastrula stage embryo probed for Ci-bra expression following egg micro-injection of a FGF9 MO.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal view of a late gastrula cell stage embryo probed for Ci-Bra expression. Staining is observed in the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal views of late gastrula embryos probed for Ci-Bra expression following injection of FGF9-MO. Staining observed in the notochord is perturbed compare to the control.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal views of late gastrula embryos probed for Ci-Bra expression following injection of FGF9-MO, FGF8-MO and bFGF. Staining observed in the notochord is perturbed compare to the control.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal view of a late gastrula stage embryo probed for Ci-Bra expression following injection of FGF9-MO and FGF8-MO. Staining observed in the notochord in the control is lost in the majority of embryos (cf. graph).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

vegetal view (dorsal is up) of a late-gastrula stage embryo stained for Ci-Bra mRNA by in situ hybridization.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

WT expression of brachyury in late gastrulae, dorsal view. Expression is seen in the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Dorsal view of a late gastrula obtained from fertilised eggs injected with dnRas mRNA.Brachyury expression is lost, indicating dependence on an intact ras signalling pathway. Control sibling embryo shows the wild type pattern of the gene.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal view of a late gastrula stage embryo electroporated with a construct that contains the Ci-Bra cis regulatory region from -3.5kb to the first 17 codons. Both primary and secondary notochord lineage cells are stained in the right half of the embryo. The expression in 10 of the 20 notochord precursors suggesting that the transgene was retained in 1 of the 2 blastomeres at the 2-cell stage. The stained cells are beginning to invagine into the blastocoel.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) secondary notochord lineage (B8.6 line) -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Neural plate view of a Mid neurula stage wild type probed for Ci-brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : notochord

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Lateral view of a neurula wild type embryo probed for Ci-bra expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

A neurula embryo probed for Ci-bra expression following the injection of Ci-Mras MO1.

Original Annotation : Bra expression was lost in notochord following the injection of Ci-Mras MO1.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Dorsal view of a mid neurula stage embryo, electroporated with a construct containing the Ci-Bra cis regulatory region from -3.5kb to the first 17 codons. Staining is detected in the notochord lineage cells derived from one side of the embryo.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) secondary notochord lineage (B8.6 line) -

C. robusta formely Ciona int. type A, Stage 16 (late neurula)

Read more…

Horizontal view of a mid-neurula stage embryo stained for Ci-Bra mRNA by in situ hybridization.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) secondary notochord lineage (B8.6 line) -

C. robusta formely Ciona int. type A, Stage 16 (late neurula)

Read more…

WT expression of brachyury in late neurulae, dorsal view. Expression is seen in the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 16 (late neurula)

Read more…

Dorsal view of a late neurula incubeted in the MEK inhibitor PD184352 from the 8-cell stage.Brachyury expression is lost, indicating dependence on an intact MEK signalling pathway. Control sibling embryo shows the wild type pattern of the gene.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 17 (initial tailbud I)

Read more…

Dorsal view of a initial tailbud stage wild type probed for Ci-brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Latreal view (pic C) of an early tailbud wild type embryo probed for Ci-Bra with the GFP like reporter. The second picture is a enlarged screen of the notochord.
The Ci-Brachyury expression was in green due to GFP.

Original Annotation : Ci-Brachyury was expressed in notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : notochord

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Sagittal view of an early tailbud stage embryo, electroporated with a construct containing Ci-Bra cis regulatory region from -3.5kp to the first 17 codons. The notochord cells are undergoing the of intercalation, which appears to proceed in an anteroposterior wave. The anterior cells are already arrayed in a single column of cells, while those in more posterior regions have not completed intercalation.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Picture 1 : Sagittal view of a early-tail bud stage embryo, electroporated with a construct containing the 3.5kb Ci-Bra promoter driving the expression of a lacZ reporter gene containing a nuclear localization signal. Intercalation is complete, the stained notochord cells are arrayed in a single column cells that run along the length of the tail.

Picture 2 : Similar to picture 1, except that there is "ectopic" staining in the mesenchyme. This expression might reflect perdurance of Ci-Bra-lacZ products activated in the B7.3 secondary lineage precursor cell, wich specifies both notochord and mesenchyme cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

View of cleavage arrested (from 110-cell stage) of early tailbud stage embryos electroporated with the Brachyury cis-regulatory region (3.5 Kb upstream the TSS of brachyury gene ci0100134430). The reporter contruct is detected in some cases in the notochord, in other cases in notochord, muscle and mesenchyme precursors.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Lateral view of early tailbud stage embryos electroporated with the Brachyury cis-regulatory region mutated for the ZicLb2 DNA binding motif (483 Kb upstream the TSS of brachyury gene ci0100134430). Mutation in ZicLb2 DNA Binding motif reduces reporter expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Lateral view of an early tailbud stage embryo, electroporated with a construct containing the ci-Bra regulatory region from -300bp to the first 17 codons. The removal of the distal sna1 site results in a derepression of the reporter in tail muscle (orange arrowhead), staining is conserved in notochord (red arrowhead).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Sagittal view of an early tailbud stage embryo, electroporated with a truncated 300-bp Ci-Bra/lacz transgene which is mutated in the Su(H)1 binding site (GTGGGAA to GTGGcAA). This substitution results in reduced binding of a GST/Ci-Su(H) fusion protein and a weak staining in the tail muscles and trunk mesenchyme, but this mutagenized transgene is essentially inactive in the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) tail muscles -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Vegetal view of a cleavage-arrested 64-cell Ciona robustaembryo at 14 hours post fertilization electroporated with pTLacZ (Bra>LacZ) and assayed by histochemical methods for acetylcholinesterase (brown-stained cells), a highly specific marker of muscle differentiation in Ciona intestinalis and β-galactosidase (blue-stained cells).
Ache is expressed in the B-line muscle precursors, B7.6, B7.5, B7.8 and B7.7. LacZ staining is observed in the notochord precursors A7.3 and A7.7 and in a mesenchyme precursor B7.3.
Scale bar: 50μm.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) mesenchyme (B8.5 & B7.7 lines) - primary notochord lineage (A7.3 & A7.7 lines) -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud stage wild type probed for Ci-brachyury expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Brachyury.
Expression pattern : notochord

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Sagittal view of a mid tailbud stage embryo stained for Ci-Bra mRNA by in situ hybridization.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) secondary notochord lineage (B8.6 line) -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud, electroporated with a construct containing the 3.5 kb Ci-Bra promoter driving the expression of a lacZ reporter gene. Half of the primary lineage and secondary lineage notochord cells are stained, although the posterior secondary lineage cells are more lightly stained than the primary lineage cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) secondary notochord lineage (B8.6 line) -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud, electroporated with a construct containing the 3.5 kb Ci-Bra promoter driving the expression of a lacZ reporter gene. The reporter reproduced the spatial expression pattern of endogenous Ci-Bra at tailbud.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid tailbud embryos electroporated in fertilized eggs with the Brachyury cis-regulatory region (3.5 Kb upstream the TATA box of brachyury gene ci0100134430) that is mutated in the two potential ZicL DNA binding motifs (B1: CACAGCTGG (seq complementaire: CCAGCTGTG) go to CAgAcgTcG (CgAcgTcTG) and B2: CCAGCTGTG go to CgAcgTcTG ). Mutation in both ZicL DNA binding motif reduce the reporter expression compare to the non mutated 3.5Kb construct or with the two constructs mutated only in one ZicL DNA binding motif (B1 or B2). By opposition this constuct didn't abolish reporter expression as the 483 bp construct mutated in the two ZicL DNA binding motifs.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid-tailbud embryos electroporated in fertilized eggs with the Brachyury cis-regulatory region (3.5 Kb upstream the TSS of brachyury gene ci0100134430) that is mutated in the ZicL-b1 DNA binding motifs (B1: CACAGCTGG (seq complementaire: CCAGCTGTG) go to CAgAcgTcG (CgAcgTcTG) ). Mutation in ZicL-b1 DNA binding site reduces expression of the reporter in notochord cells. About 53% of stained embryos still exhibit the reporter expression in most notochord cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid tailbud embryos electroporated in fertilized eggs with the Brachyury cis-regulatory region (3.5 Kb upstream the TATA box of brachyury gene ci0100134430) that is mutated in ZicLb2 DNA binding motifs (B2: CCAGCTGTG go to CgAcgTcTG ). Mutation in ZicLb2 DNA binding motif did not induce a significante expression level decrease of reporter in notochord cells compare to the same construct mutated in ZicLb1 DNA binding motif.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Mid tailbud stage embryo electroporated with a lacZ transgene containing the -839bp Ci-Bra regulatory sequence (construct named -790bp in the publication). Staining is observed in notochord. No picture available in the paper.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Sagittal view of a mid tailbud stage embryo, electroporated with a construct containing the minimal 483bp Ci-Bra promoter driving the expression of a lacZ reporter gene. Intense staining is observed in the notochord cells (red arrow) and weak expression is also detected in the trunk mesenchyme.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Sagittal view of mid tailbud stage embryo electroporated with a construct containing the cis- regulatory region of Ci-Bra gene (-483pb upstream the TSS to the 17 first codons. LacZ is detectable in notochord (red arrowhead) and mesenchyme.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid tailbud stage embryos electroporated with the Brachyury cis-regulatory region mutated for the two ZicL DNA binding motif (483 Kb upstream the TSS of brachyury gene ci0100134430). Mutation in the two ZicL DNA Binding motif abolishes reporter expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid tailbud stage embryos electroporated in fertilized eggs with the Brachyury cis-regulatory region (483 kb upstream the TSS of brachyury gene ci0100134430). The 3,5 kb genomic DNA fragment upstream from the CiBra transcription start site contains the cis-regulatory information required for authentic Ci-Bra expression, since it mediate a precise notochord-specific expression pattern of reporter gene in transgenic embryos, while the 483bp region appeared to possess minimal enhancer activity.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid tailbud stage embryo electroporated in fertilized eggs with the Brachyury cis-regulatory region (483bp upstream the TSS of brachyury gene ci0100134430). Staining is detected in notochord (black arrow) and sometimes in mesenchyme (white arrow).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Sagittal view of a mid tailbud stage embryo, electroporated with a construct containing the minimal 483bp Ci-Bra promoter driving the expression of a lacZ reporter gene containing a nuclear localization signal. Expression is restricted to the notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud stage embryo electroporated with the Brachyury cis-regulatory region in which there is a spacer inserted between the sna1 site (-350/-322) and Su(H)1 site (-261/-253) (483bp upstream the TSS of brachyury gene ci0100134430). Staining is detected in all mesodermal lineage, including notochord (arrow) and tail muscles (arrowhead) and in cerebral vesicle of the CNS (open arrowhead).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) anterior sensory vesicle - mesoderm -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud stage embryo electroporated with the Brachyury cis-regulatory region in which there is a spacer inserted between the Su(H)2 site (-246/-248) and the sna2 site (-222/-214) (483bp upstream the TSS of brachyury gene ci0100134430). Staining is detected in all mesodermal lineage and in some ependymal cells of the spinal cord (open arrowhead).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) caudal epidermal neurone (CEN) precursors - mesoderm -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid tailbud stage embryo electroporated in fertilized eggs with the Brachyury cis-regulatory region deleted for the Snail DNA binding located between -222/-214 upstream the transcription start site in which there insert the drosophila sna DNA binding site (483bp upstream the TSS of brachyury gene ci0100134430). Staining is detected in notochord that reveal cis complementation between drosophila and Ciona sna DNA binding sites.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Sagittal view of a mid tailbud stage embryo electroporated with a construct containing the minimal 483bp Ci-Bra/lacZ enhancer which contains nucleotides changes just outside of each Ci-Su(H) recognition sequence. A normal staining pattern is observed, with the levels of expression slightly higher than normal.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud stage embryo electroporated with Brachyury cis-regulatory region deleted for the Snail DNA bindind located between -330/-322 upstream the start of transcription (483bp upstream the TSS of brachyury gene ci0100134430). Staining is detected in notochord and tail muscle, sometimes in mesenchyme. Disrupting Snail DNA binding site results in lost of repression of the transgene in tail muscle.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud stage embryo electroporated with Brachyury cis-regulatory region deleted for the Snail DNA bindind site, located between -222/-214 upstream the start of transcription (483bp upstream the TSS of brachyury gene ci0100134430). Staining is detected in notochord and tail muscle, sometimes in mesenchyme. Disrupting Snail DNA binding site results in the lost of repression of the transgene in tail muscle. Comparing the two deletion in sna1 and Sna2 DNA binding sites suggest that there are both required for efficient repression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid tailbud stage embryos electroporated with the Brachyury cis-regulatory region mutated for the ZicLb1 DNA binding motif (483 Kb upstream the TSS of brachyury gene ci0100134430) . Mutation in ZicLb1 DNA Binding motif abolishes reporter expression.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

mid tailbud stage embryo electroporated with a lacZ transgene containing the -363bp Ci-Bra regulatory sequence (construct named -299bp in the publication). Ectopic staining is observed in tail muscles. No picture available in the paper.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

mid tailbud stage embryo electroporated with a lacZ transgene containing the -324bp Ci-Bra regulatory sequence (construct named -275bp in the publication). Ectopic staining is observed in tail muscles. No picture available in the paper.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud stage embryo electroporated with Brachyury cis-regulatory region (300bp upstream the TSS of brachyury gene ci0100134430). Staining is detected in notochord, mesenchyme and tail muscle (due to deletion of the first sna DNA binding site upstream -300bp).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid-tailbud stage embryo electroporated with the Ci-Bra cis regulatory region from -300bp to the 17 first codons in which a drosophila Sna binding site (CACCTTGCTGGG) was inserted in 5 of the su(H)1 site. Staining is detected in notochord that reveal cis complementation between drosophila and Ciona sna DNA binding sites.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Picture 1 : Lateral view of a mid tailbud stage embryo electroporated with a lacZ transgene containing the -299bp Ci-Bra regulatory sequence (construct named -250bp in the publication). Strong staining is observed in the notochord. Ectopic staining is observed in tail muscles (arrow).

Picture 2 : The same transgene as the one used in the picture 1 sometimes shows ectopic staining in the mesenchyme and in the tail muscles (arrow).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid-tailbud stage embryo, electroporated with a lacZ transgene containing the truncated -299bp Ci-Bra promoter gene (construct named -250bp in the publication). This Ci-Bra promoter fragment lacks the distal repression element, so ectopic staining is observed in the muscles and trunk mesenchyme. Strong staining is observed in both the notochord and ectopic mesodermal tissues.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord - tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of mid-tailbud stage embryo electroporated with a lacZ transgene containing the truncated -299 bp Ci-Bra promoter fragment containing an internal 24 bp deletion that removes the putative Su(H) binding sites (construct named -250bp w/o Su(H) in the publication). Staining is selectively lost in the notochord, but ectopic expression persists in the other mesodermal lineages, the tail muscles and mesenchyme.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) tail muscles -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Picture 1 : Lateral view of a late tailbud stage embryo, electroporated with a lacZ transgene containing the Ci-Bra cis regulatory region from -191 bp to the first 17 codons. This construct lacks one of the three E-box sequences. Staining is essentially lost in the notochord, but ectopic expression continues to be observed in some tissues. In this embryo, the central group of 8 muscle cells expresses the transgene.

Picture 2 : The same transgene sometimes shows ectopic expression in both tail muscles and mesenchyme.

Ectopic expression may be due to the removal of repressor binding site(s).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) tail muscles -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

A view (pic D) of a late tailbud wild type embryo probed for Ci-Bra after the electroporation of Bra::GFP. The second picture is a enlarged screen of the notochord.
The Ci-Brachyury expression was in green due to GFP.

Original Annotation : Ci-Brachyury was expressed in notochord. This gene is responsible of the right intercalation of the cells of notochord to form a single cell row.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Lateral view of a Ciona robusta late tailbud embryo immunostained with the Ci-Bra-specific antibody (red), electroporated with Ci-Bra>GFP (green) and counterstained with DAPI (blue nuclei)
Ci-Bra is observed in the nuclei of the 40 notochord cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Tailbud stage embryo, microinjected with a transgene containing the 483bp minimal Ci-Bra enhancer attached to a GFP reporter gene. The tail wraps around the central trunk since this living embryo is contained within an intact chorion. Staining is observed in half of the primary lineage notochord cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Tailbud stage embryo, microinjected with a transgene containing the 483bp minimal Ci-Bra enhancer attached to a GFP reporter gene. Staining is observed in 4 of the 8 secondary lineage notochord cells.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) secondary notochord lineage (B8.6 line) -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Tailbud stage embryo, microinjected with a transgene containing the 483bp minimal Ci-Bra enhancer attached to a GFP reporter gene. Staining persists in half the notochord cells. By this time the individual notochord cells have become irregular in shape and flattened against the surrounding sheath.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Picture 1 : Sagittal view of a late tailbud stage embryo, electroporated with a lacZ transgene containing the minimal 483pb Ci-Bra enhancer. Staining obtained with the intact minimal 483pb Ci-Bra is restricted to 25% of the primary lineage notochord cells.

Picture 2 : The same transgene as that used in the picture 1 shows ectopic staining in the mesenchyme. Mesenchyme staining is often associated with strong expression in secondary lineage notochord cells. It is possible the lacZ reporter mRNA lacks a signal sequences required for asymmetric localization.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) secondary notochord lineage (B8.6 line) -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Late tail bud stage embryo, electroporated with a lacZ transgene containing the minimal -483bp Ci-Bra promoter containing an internal 24bp deletion that removes the putative Su(H) binding sites. This deletion within this transgene results in a severe reduction in the expression of the transgene (no picture available).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Late tailbud stage embryo, electroporated with a lacZ transgene containing the minimal -483bp Ci-Bra promoter containing an internal deletion that removes the three tandem repeats of a 15bp sequence. This deletion within this transgene results in a reduction in the expression of the transgene in notochord (no picture available).

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Late tailbud stage embryo, electroporated with a lacZ transgene containing the -143 bp Ci-Bra promoter sequence. This construct lacks 2 of the 3 E-box sequences. No staining in the notochord is detected and there is a severe reduction in the ectopic expression in the muscles and mesenchyme. No picture is available.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) tail muscles -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Late tailbud stage embryo, electroporated with a lacZ transgene containing the Ci-Bra cis regulatory region from -71bp to the first 17 codons. This construct lacks the 3 E-box sequences. No staining is detected in the notochord and the ectopic expression in the muscles and mesenchyme which is detected when the E-box sequences are present, is absent. No picture is available.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 25 (late tailbud III)

Read more…

View of a tail from tabued embryos. Original annotation: expression of Brachyury>mCherry (red) int he notochord.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -

C. robusta formely Ciona int. type A, Stage 26 (hatching larva)

Read more…

Dorso-lateral view of a larva electroporated with pBra>RFP. Signal is detected in 12 to 20 cells of the notochors in 95% of the electroporated embryos.

Stained molecule KH2012:KH.S1404.1 (TBX19; TBX6; TBXT)
Stained region(s) notochord -