Login
Help

GENE CARD

Submit your Data

EST count

27 results

Library Name Percentage Expression
Ciona intestinalis whole animal Ciona intestinalis whole animal 0 clone(s) / 0
Nori Satoh unpublished cDNA library Nori Satoh unpublished cDNA library 0 clone(s) / 5,577
Nori Satoh unpublished cDNA library, young adult Nori Satoh unpublished cDNA library, young adult 0 clone(s) / 31,366
Nori Satoh unpublished cDNA library, cleavage stage embryo Nori Satoh unpublished cDNA library, cleavage stage embryo 6 clone(s) / 15,579
Nori Satoh unpublished cDNA library, egg Nori Satoh unpublished cDNA library, egg 1 clone(s) / 31,100
Nori Satoh unpublished cDNA library, larva Nori Satoh unpublished cDNA library, larva 3 clone(s) / 26,704
Nori Satoh unpublished cDNA library, tailbud embryo Nori Satoh unpublished cDNA library, tailbud embryo 4 clone(s) / 26,680
directional larval cDNA library directional larval cDNA library 0 clone(s) / 39
Ascidian hemocytes cDNA library Ascidian hemocytes cDNA library 0 clone(s) / 0
K. Inaba unpublished cDNA library, testis K. Inaba unpublished cDNA library, testis 0 clone(s) / 5,468
Stratagene UniZAP whole-larva library Stratagene UniZAP whole-larva library 0 clone(s) / 0
Ciona intestinalis larva Ciona intestinalis larva 0 clone(s) / 0
Nori Satoh unpublished cDNA library, blood cells Nori Satoh unpublished cDNA library, blood cells 0 clone(s) / 29,579
Nori Satoh unpublished cDNA library, endostyle Nori Satoh unpublished cDNA library, endostyle 0 clone(s) / 2,556
Nori Satoh unpublished cDNA library, cleaving embryo Nori Satoh unpublished cDNA library, cleaving embryo 4 clone(s) / 16,939
Nori Satoh unpublished cDNA library, gastrula and neurula Nori Satoh unpublished cDNA library, gastrula and neurula 9 clone(s) / 25,258
Nori Satoh unpublished cDNA library, gonad Nori Satoh unpublished cDNA library, gonad 0 clone(s) / 16,936
Nori Satoh unpublished cDNA library, neural complex Nori Satoh unpublished cDNA library, neural complex 1 clone(s) / 10,463
Nori Satoh unpublished cDNA library, heart Nori Satoh unpublished cDNA library, heart 0 clone(s) / 13,243
Yutaka Satou unpublished cDNA library, adult digestive gland Yutaka Satou unpublished cDNA library, adult digestive gland 0 clone(s) / 17,765
Yutaka Satou unpublished cDNA library, embryo whole animal Yutaka Satou unpublished cDNA library, embryo whole animal 0 clone(s) / 17,872
Yutaka Satou unpublished cDNA library, mature adult whole animal Yutaka Satou unpublished cDNA library, mature adult whole animal 1 clone(s) / 107,314
Nori Satoh unpublished cDNA library, juvenile whole animal Nori Satoh unpublished cDNA library, juvenile whole animal 1 clone(s) / 24,372
Nori Satoh unpublished cDNA library, mature adult whole animal Nori Satoh unpublished cDNA library, mature adult whole animal 0 clone(s) / 17,126
Ciona intestinalis whole animal stage3 juvenile Ciona intestinalis whole animal stage3 juvenile 0 clone(s) / 3,798
Yutaka Satou unpublished library (cicx) Yutaka Satou unpublished library (cicx) 0 clone(s) / 2,031
Gateway compatible cien cDNA library, Ciona intestinalis mixed embryonic stages (Egg to Neurula) Gateway compatible cien cDNA library, Ciona intestinalis mixed embryonic stages (Egg to Neurula) 16 clone(s) / 188,431

RNA-Seq transcriptome profiles (by Experiment)

3 results

OVERVIEW

   Expression profile summary from all experiments in WT and mutant conditions:
FPKM & RPKM

Click here to see the RNA-Seq Pipeline Protocol.
You can show/hide lines in the charts by clicking on it in the legend part.
You can see more details by clicking on a point and then, on the link which will appear.

Be careful, FPKM & RPKM does not permit you to compare a gene across different conditions or experiments.

Download FPKM & RPKM data

OVERVIEW

   Expression profile summary from all experiments in WT and mutant conditions:
Relative Log Expression RLE

Be careful, RLE and 2RLE does not permit you to compare a gene across different experiments.

Download RLE Relative Log Expression data

RNA-Seq Experiment n°34135

Read more…

Oocytes of a single individual of Ciona intestinalis (Roscoff, France) were fertilized by a mixture of sperm of two individuals and development was followed microscopically. Embryos were snapfrozen in liquid nitrogen at the appropriate stage and kept at -80°C. Samples at stage 0, 8, 12, 15, 21, 26 were collected from the same fertilzation, while sample from stage 11 was independently collected from a different individual. Total RNA was prepared with the RNA II kit of Magerey Nagel and the quality was checked with the Bioanalyzer, all samples had a RIN value of higher than 9. Strand specific libraries were constructed and the sequencing (50PE) was performed with Illumina HiSeq 2000 technology (BGI, Hong Kong, China). Reads were aligned onto C.robusta genome and considered to reflect the expression of the C.robusta orthologous genes.

Assay platform Illumina HiSeq 2000
Layout Paired-end
Stranded Yes
Read length 49
Normalized data types
  • FPKM
  • RLE
Wild type - Replica 1
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 0 (Unfertilized egg)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 11 (early gastrula)
C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)
C. robusta formely Ciona int. type A, Stage 15 (mid neurula)
C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)
C. robusta formely Ciona int. type A, Stage 26 (hatching larva)
Wild type - Replica 2
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 0 (Unfertilized egg)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 11 (early gastrula)
C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)
C. robusta formely Ciona int. type A, Stage 15 (mid neurula)
C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)
C. robusta formely Ciona int. type A, Stage 26 (hatching larva)

RNA-Seq Experiment n°34138

Read more…

Ciona robusta adults were obtained from the National Bio-Resource Project for Ciona (NBRP, Japan). 50 unperturbed and Foxd-morphant embryos were collected at the 32-, 64-, and 112-cell stages. RNA was extracted using a Dynabeads mRNA DIRECT Purification Kit (Thermo Fischer Scientific) and libraries were made with an Ion Total RNA-Seq kit ver 2 (Thermo Fischer Scientific). The libraries were sequenced with an Ion PGM instrument (Thermo Fischer Scientific).

Assay platform Ion Torrent PGM
Layout Single-end
Stranded Yes
Read length 20-365
Normalized data types
  • RPKM
Wild type
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 10 (112-cell)
Mutant
Deregulated molecule(s) KH2012:KH.C8.890 -
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)
C. robusta formely Ciona int. type A, Stage 8 (64-cell)
C. robusta formely Ciona int. type A, Stage 10 (112-cell)

RNA-Seq Experiment n°34139

Read more…

The purpose of this project is to identify genes positively and negatively regulated by signaling molecules that belongs to the TGFbeta superfamily.

Assay platform Illumina HiSeq 2500
Layout Single-end
Stranded Yes
Read length 101
Normalized data types
  • RPKM
Wild type
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 13 (late gastrula)
Mutant 1
Deregulated molecule(s) KH2012:KH.C4.125 -
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 13 (late gastrula)
Mutant 2
Deregulated molecule(s) KH2012:KH.C2.573 -
Territories whole embryo -
Biomaterial(s) C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

In Situ Experiment Data

191 results

Experiment data ( results)

C. robusta formely Ciona int. type A, Stage 1 (One cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satous gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : Unlocalized signal was detected.
Comment : Maternal weak signal was observed ubiquitously mainly in the early claeving stages.

Aniseed annotation :
No picture was detected on Ghost

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) whole embryo -

C. robusta formely Ciona int. type A, Stage 5a (early 16-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satous gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : No distinct zygotic signal was detected.
Comment : Maternal weak signal was observed ubiquitously mainly in the early claeving stages.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) whole embryo -

C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)

Read more…

Animal views with anterior to the top of a 32-cell stage embryo stained with Otx. Anterior ectoderm is marked in white, posterior ectoderm in yellow and gene expression in blue. Expression was observed in the a6.5, b6.5 and B6.4 cell pairs.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)

Read more…

Vegetal (left) and animal (right) views of a WT Ciona robusta probed for Otx expression at the early 32-cell stage.
Original comment: Otx is expressed in three pairs of vegetal cells (B6.1, B6.2, and B6.4) and two pairs of animal cells (a6.5 and b6.5) at the 32-cell stage in normal embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.1 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)

Read more…

Vegetal (left) and animal (right) views of a Ciona robusta Foxd morphant probed for Otx expression at the early 32-cell stage.
Original comment: Otx was ectopically expressed in the anterior vegetal cells (A6.1 to A6.4) of Foxd morphants.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A6.1 cell pair - A6.2 cell pair - A6.3 cell pair - A6.4 cell pair - a6.5 cell pair - B6.1 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : B6.1, B6.2, B6.4.

Aniseed annotation :
This corresponds to the early 32-cell stage morphology and expression profile, hence the stage change compared to the original annotation.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.1 cell pair - B6.2 cell pair - B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)

Read more…

Animal view of a 32 cell stage embryo showing Ci-otx expression in B6.2 and B6.4 cell pairs. B6.1 expression can be seen through the embryo due to its transparency.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.1 cell pair - B6.2 cell pair - B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of Otx expression at 32-cell stage.
Otx is expressed in a6.5 and b6.5 neural precursors (black arrowheads) and in B6.4 and B6.2 vegetal blastomeres (arrows).
All experiments from this article where performed on Type A Ciona intestinalis embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Otx is expressed specifically in the neural lineage of embryos injected with a control morpholino oligonucleotide.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a 32-cell stage embryo stained with Otx.
Expression was observed in the a6.5, a6.7 and b6.5 (black arrowheads) as well as in the B6.2 and B6.4 cell pairs (blue arrowheads: vegetal cells).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.7 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a 32-cell stage embryo labeled with a-element of Otx>LacZ driven by Bachyury basal promoter. Expression was observed in a6.5 and b6.5 cell pairs (blach arrowheads: endogenous Otx expression), in a6.8, b6.6 and b6.7 cell pairs (red arrowheads: ectopic expression) as well in the B6.2 cell pair (blue arrowheads: vegetal cells).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.8 cell pair - B6.2 cell pair - b6.5 cell pair - b6.6 cell pair - b6.7 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a WT Ciona robusta 32-cell stage embryo probed for Otx expression.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7 an A6.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A6.4 cell pair - a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6 and B6.2.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6, b6.6 and b6.8.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair - b6.6 cell pair - b6.8 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7 an A6.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A6.4 cell pair - a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6 and B6.2.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6, b6.6 and b6.8.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair - b6.6 cell pair - b6.8 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7 an A6.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A6.4 cell pair - a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6 and B6.2.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6, b6.6 and b6.8.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair - b6.6 cell pair - b6.8 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 1 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 2 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7 an A6.4.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A6.4 cell pair - a6.5 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 4 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6 and B6.2.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

Animal view of a Ciona robusta 32-cell stage embryo probed for Otx expression and treated with 8 μM NVPBHG712 from the 16-cell stage to inhibit Eph-mediated signalling.
Otx is expressed in a6.5, B6.4 and b6.5 cell pairs and ectopically in a6.7, a6.6, b6.6 and b6.8.
Original comment: Treatment of Ciona embryos from the 16-cell stage with NVPBHG712 leads to ectopic expression of Otx. The severity of the phenotype is concentration-dependent.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.7 cell pair - B6.4 cell pair - b6.5 cell pair - b6.6 cell pair - b6.8 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo. Ci-Otx expression appears in B6.1, B6.2 and B6.4 blastomeres.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.1 cell pair - B6.2 cell pair - B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo. Effects of overexpression of ci-macho1 revealed by whole-mount in situ hybridization. Ci-macho1 overexpression caused ectopic activation of Ci-Otx in various vegetal blastomeres.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A line - B line -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo. Effects of functionnal suppression of ci-macho1 revealed by whole-mount in situ hybridization. Ci-Otx expression was undectectable in Ci-macho1-suppressed embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of Otx expression where Admp and FGF9/16/20 expressions are disrupted, at 32-cell stage.
Otx is expressed in B6.4 vegetal blastomeres only (black arrows).
Original annotation : white arrowheads indicate that the expression of Otx in the neural lineage was lost.
The picture is representative of 98% of the 50 scored embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of Otx expression where KH2012:KH.C4.547 (called Gdf1/3-r in this article) and FGF9/16/20 expressions are disrupted, at 32-cell stage.
Otx expression is lost as well in the neural lineage (white arrowheads) as in the B6.2 and B6.4 vegetal blastomeres.
The picture is representative of 100% of the 20 scored embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of Otx expression where Admp, FGF9/16/20 and KH2012:KH.C4.547 (called Gdf1/3-r in this article) expressions are disrupted, at 32-cell stage.
Original annotation : Otx is not expressed on a morphant for Fgf9/16/20, Admp and Gdf1/3-r.
Aniseed annotation : Otx neural expression is lost, but its expression in B6.4 blastomeres remains.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of Otx expression in a 32 cell-stage embryo where Admp, FGF9/16/20 and KH2012:KH.C4.547 (called Gdf1/3-r in this article) expressions were disrupted and treated with human bFGF and BMP4.
Original annotation : Otx is specifically expressed in the neural lineage of morphants for Fgf9/16/20, Admp and Gdf1/3-r incubated with 1ng/mL human bFGF and 1OOng/mL human BMP4, although no differential inputs of Fgf9/16/20, Admp and Gdf1/3-r are expected.
Aniseed annotation : Otx expression in B6.2 and B6.4 blastomeres is unchanged.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of Otx expression in a 32-cell stage embryo where Admp, Efna.d, FGF9/16/20 and KH2012:KH.C4.547 (called Gdf1/3-r in this article) expressions are disrupted and treated with human bFGF and BMP4.
Original annotation : Otx expression is observed not only in the neural lineage (black arrowheads) but also in the epidermal lineage (red arrowheads) of morphant for Fgf9/16/20, Admp, Gdf1/3-r and Efna.d incubated with bFGF and BMP4.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - a6.6 cell pair - a6.8 cell pair - b line -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo, showing expression of Ci-Otx.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.1 cell pair - B6.2 cell pair - B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo showing expression of Ci-Otx, following injection of Ci-ZF278 MO.

Original annotation:
Expression of Ci-Otx, which normally is expressed in B6.1, B6.2 and B6.4 blastomeres of the 32-cell stage embryo, was detected only in B6.4 of Ci-β-catenin knockdown embryos, and the identical change was found in embryos knocked down for Ci-ZF278.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo showing expression of Ci-Otx, following injection of Ci-Spatial/C4orf17 MO.

Original annotation:
Expression of Ci-Otx, which normally is expressed in B6.1, B6.2 and B6.4 blastomeres of the 32-cell stage embryo, was detected only in B6.4 of Ci-β-catenin knockdown embryos, and the identical change was found in embryos knocked down for Ci-Spatial/C4orf17.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo showing expression of Ci-Otx, following injection of Ci-FLJ10634 MO.

Original annotation:
Expression of Ci-Otx, which normally is expressed in B6.1, B6.2 and B6.4 blastomeres of the 32-cell stage embryo, was detected only in B6.4 of Ci-β-catenin knockdown embryos, and the identical change was found in embryos knocked down for Ci-FLJ10634.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo showing expression of Ci-Otx, following injection of Ci-beta-catenin MO.

Original annotation:
Expression of Ci-Otx, which normally is expressed in B6.1, B6.2 and B6.4 blastomeres of the 32-cell stage embryo, was detected only in B6.4 of Ci-beta-catenin knockdown embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetatil view of a late 32-cell stage embryo, showing expression of Ci-Otx, following injection of Ci-C10orf11 MO.

Original annotation:
Expression of Ci-Otx, which normally is expressed in B6.1, B6.2 and B6.4 blastomeres of the 32-cell stage embryo, was detected only in B6.4 of Ci-β-catenin knockdown embryos, and the identical change was found in embryos knocked down for Ci-C10orf11.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Vegetal view of a late 32-cell stage embryo, showing expression of Ci-Otx, following injection of Ci-PAGP1 MO.

Original annotation:
Expression of Ci-Otx, which normally is expressed in B6.1, B6.2 and B6.4 blastomeres of the 32-cell stage embryo, was detected only in B6.4 of Ci-β-catenin knockdown embryos, and the identical change was found in embryos knocked down for Ci-PAGP.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a late 32 cell stage embryo showing Ci-otx expression in B6.2 and B6.4 cell pairs. B6.1 expression can be seen through the embryo due to its transparency. Expression also detected in a6.5 and b6.5 cell pairs.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.1 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view (anterior is up) of an Xgal staining of late 32-cell stage Ciona intestinalis embryo electroporated with the indicated Otx cis regulatory region. No LacZ protein activity is detected eventhough lacZ mRNA is detected at the same stage in the accompanying picture.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view (anterior is up) of a late 32-cell stage embryo stained for LacZ mRNA by in situ hybridization. Note that expression of the transgene is mosaic. Expression in B6.1 is driven by the construct but cannot be seen on this picture.
LacZ mRNA is present at this stage but LacZ protein has not yet been synthesized (see accompanying Xgal stained embryo)

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.1 cell pair - B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 6b (late 32-cell)

Read more…

Animal view of a 32-cell stage embryo stained LacZ reporter gene of the Otx[SBE-a]>LacZ construct containing two putative Smad binding element and one binding element for Smad4 as well as the a-element of Otx.
Expression was observed in the b6.5 cell pair (black arrowheads: endogenous Otx expression) as well as in the B6.2 and B6.4 cell pairs (blue arrowheads: vegetal cells).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.2 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

A 44-cell stage wild type embryo probed for Ci-otx expression.

Original Annotation : Otx was expressed in a6.5 (arrowheads), b6.5 and B6.4.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

A 44-cell stage embryo probed for Ci-otx expression following the injection of Ci-Mras MO1.

Original Annotation : Otx was still expressed in b6.5 and B6.4 but expression in a6.5 was lost (arrows).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B line -

Stained molecule KH2012:KH.C5.5 (FGF17; FGF18; FGF8)
Stained region(s) A line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Control picture shows the otx expression pattern in sibbling uninjected embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal view (anterior is up) of 44-cell stage embryo injected with Ets1/2-MO (Ets1/2 morpholino: CATGTTGGTCTACCATGTTTCTGAA) and stained for Otx mRNA (AF305499). The control picture shows the normal otx expression pattern in a sibbling uninjected embryo. Loss of expression was observed in 63/84 embryos analysed.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal view (anterior is up) of 44-cell stage embryo co-injected with GATAa-MO and Ets-1/2-MO and stained for Otx mRNA (AF305499). The control picture shows the otx expression pattern in sibbling uninjected embryos. The penetrance of the loss of expression phenotype is higher when both morpholinos are co-injected (100%) than when either ETS MO (75%) or GATA MO (40%).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal view (anterior is up) of 44-cell stage embryo injected with GATAa-MO (GATAa morpholino: GGGTTAGGCATATACATTCTTTGGA) and stained for Otx mRNA (AF305499). The control picture shows otx expression in a control sibbling uninjected embryo. Loss of expression in animal neural lineages was observed in 18/44 embryos analysed.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

The control picture shows otx expression in a sibbling uninjected embryo.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal view (anterior is up) of a 44-cell stage embryo injected with FGF9-MO (FGF9 morpholino: TTGAGTTTGTAGACTGTTGCTGCTG) and stained for Otx mRNA (AF305499). The control picture shows otx expression in a sibbling uninjected embryo.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal explant (b4.2) of a 44-cell stage embryo, treated with 100ng/ml bFGF from the 8- to 44-cell stage and probed for Ci-otx expression in bFGF. Otx is activated in all cells.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal explant (b4.2) of a 44-cell stage embryo, treated with 100ng/ml bFGF from the 8- to 44-cell stage and probed for Ci-otx expression in bFGF. Otx is activated in all cells.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) b line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal explant (a4.2) treated with 100ng/ml bFGF from the 8- to the 44-cell stage and probed for Ci-otx expression in bFGF.(96% positive, n=27)

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal view of a 44 cell stage embryo showing Ci-otx expression in a6.5, b6.5 and B6.4 cell pairs.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal view of a 44-cell embryo stained for Otx mRNA by ISH. Expression is seen in the a6.5, b6.5, and B6.4 blastomeres.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a6.5 cell pair - B6.4 cell pair - b6.5 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

Animal view of a 44-cell embryo treated with the mEK inhibitor PD184352 from the 8 cell stage and stained for Otx mRNA by ISH. Expression is lost from the a6.5, b6.5 blastomeres.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at the 8-cell stage from embryos injected with FGF9/16/20 mRNA (AB086097) before fertilization. Satining was for Otx mRNA (AF305499). FGF9/16/20 drive expression of endogenous Otx throughout the cap. The control picture corresponds to an animal cap from a sibbling uninjected embryo.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at the 8-cell stage, cultured in sea water and stained for Otx mRNA (AF305499).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at 8-cell stage, treated with 200microg/ml of protein synthesis inhibitor (puromycin, Sigma P7255) from 8-cell stage and stained for Otx mRNA. The control corresponds to animal caps cultured in normal sea water.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

a4.2 anterior animal explant of a 44-cell stage embryo probed for Ci-otx expression. The explant was cultured in sea water. Otx expression is lost, revealing a role for a vegetal inductive signal.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at 8-cell stage, treated with 200microg/ml of protein synthesis inhibitor (puromycin, Sigma P7255) and with 100microg/ml of bFGF (Sigma, F0291) to mimic FGF9/16/20 overexpression, from 16-cell stage and stained for Otx mRNA. Animal cap explants show puromycin independent expression of Otx mRNA. The controls show: 1) activation of otx by FGF in the absence of puromycin in sibbling caps . 2) lack of activation of otx by puromycin alone in sibbling caps. 3) lack of activation in sibbling caps cultured in normal sea water.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at 8-cell stage, treated with 100 ng/ml of bFGF (Sigma,F0291)to mimic FGF9/16/20 overexpression, from 16-cell and stained for Otx mRNA. The control picture corresponds to animal caps at the same stage not treated with FGF.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at 8-cell stage, and stained for Otx mRNA at the 44-cell stage.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

b4.2 posterior animal explant of a 44-cell stage embryo probed for Ci-otx expression. The explant explant was cultured in sea water. Otx expression is lost, revealing a role for a vegetal inductive signal.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

44 cell stage A4.1/B4.1 explant, Ci-otx expression is observed in the B line cells (81% explants), following the normal expression pattern observed in 44 cell stage embryos although this has not been formally confirmed. Wild type 44 cell stage embryo also included showing Ci-otx expression pattern.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B6.4 cell pair -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

44 cell stage a4.2/b4.2 explant showing loss of Ci-otx expression (94% explants). Wild type control of 44 cell stage embryo showing Ci-otx expression also included.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at 8-cell stage from embryos electroporated with the a-element from the cis-regulatory region of Ci-Otx (between-1541/-1417 bp upstream the first nucleotide of cDNA AF305499), injected with FGF9/16/20 mRNA (AB086097) before fertilization and stained for LacZ activity. FGF9/16/20 drives expression of the otx a-element cis-regulatory region in all animal cells. The control picture shows animal caps from sibbling embryos not injected with FGF9/16/20.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants taken at 8-cell stage from embryos electroporated with the a-element from the cis-regulatory region of Ci-Otx (between-1541/-1417 bp upstream the first nucleotide of Otx cDNA AF305499) and stained for LacZ activity.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants taken at 8-cell stage from embryos electroporated with the a-element from the cis-regulatory region of Otx (between-1541/-1417 bp upstream the first nucleotide of Otx cDNA AF305499, treated with 200 microg/ml of protein synthesis inhibitor (puromycin, Sigma P7255) from the 8-cell stage and stained for LacZ mRNA. The control picture corresponds to animal caps of similar embryos, which were not treated with FGF.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at 8-cell stage from embryos electroporated with the a-element from the cis-regulatory region of Ci-Otx (between-1541/-1417 bp upstream the first nucleotide of Otx cDNA AF305499), treated with 200microg/ml of protein synthesis inhibitor (puromycin, Sigma P7255) from 8-cell stage, and with 100 ng/ml of bFGF (Sigma, F0291) to mimic FGF9/16/20 from 16-cell stage and stained for LacZ mRNA. Animal cap explants show strong puromycin independent expression of LacZ mRNA. Three controls are provided: 1) animal caps treated with FGF without puromycin, 2) animal caps treated with puromycin alone, 3) animal caps cultured in plain sea water

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants dissected at 8-cell stage from embryos electroporated with the a-element from the cis-regulatory region of Ci-Otx (between-1541/-1417 bp upstream the first nucleotide of Otx cDNA AF305499), treated with 100 ng/ml of bFGF (Sigma, F0291) to mimic FGF9/16/20 from 16-cell stage and stained for LacZ mRNA. Animal cap explants show strong expression of LacZ mRNA. Control: animal caps cultured in plain sea water

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 7 (44-cell)

Read more…

View of 44-cell stage animal cap explants taken at 8-cell stage from embryos electroporated with the a-element from the cis-regulatory region of Ci-Otx (between-1541/-1417 bp upstream the first nucleotide of Otx cDNA AF305499) and stained for LacZ mRNA.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Animal view with anterior to the top of a 64-cell stage embryo stained with Otx.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a7.10 cell pair - a7.9 cell pair - b7.10 cell pair - B7.7 cell pair - b7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Animal view of a Ciona robusta 64-cell stage embryo probed for Otx expression and injected with a control morpholino oligo.
Otx expression is observed in a7.9, a7.10, b7.10, b7.9 and B7.7 blastomers.
n, number of embryos examined. % : Percentages of embryos with Foxa.a expression in the a-neural lineage (cyan arrowheads).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a7.10 cell pair - a7.9 cell pair - b7.10 cell pair - B7.7 cell pair - b7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Animal view of a Ciona robusta 64-cell stage embryo probed for Otx expression and injected with morpholino oligos against Prdm1-r.a, Prdm1-r.b and Hes.a.
Otx expression is observed in a7.9, a7.10, b7.10, b7.9 and B7.7 blastomers.
Original annotation: The expression of the early neural marker gene Otx was not lost in the brain/palp lineage of Prdm1-r.a/b/Hes.a morphants. Note that Otx expression in the brain/palp lineage appeared to be stronger in Prdm1-r.a/b/Hes.a morphants than in control embryos.
n, number of embryos examined. % : Percentages of embryos with Foxa.a expression in the neural lineage (cyan arrowheads).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a7.10 cell pair - a7.9 cell pair - b7.10 cell pair - B7.7 cell pair - b7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cell stage wild type embryo probed for otx expression.

Original annotation :
Gene name :Otx.
Expression pattern : A7.1, A7.2, A7.5, A7.6, a7.9, a7.10, B7.1, B7.2, B7.3, B7.5, B7.7, B7.8, b7.9, b7.10

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a7.10 cell pair - A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A7.6 cell pair - a7.9 cell pair - b7.10 cell pair - B7.1 cell pair - B7.2 cell pair - B7.3 cell pair - B7.5 cell pair - B7.7 cell pair - B7.8 cell pair - b7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view of a 64-cells stage embryo probed for Otx expression following egg micro-injection of a FoxA-a MO. Otx was down-regulated in endodermal cells. The expression was not affected in B7.3 and B7.7.

Aniseed annotation : weak staining is detected on B7.8 cell pair.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B7.3 cell pair - B7.7 cell pair - B7.8 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : A7.1, A7.2, A7.5, A7.6, a7.9, a7.10, B7.1, B7.2, B7.3, B7.5, B7.7, B7.8, b7.9, b7.10

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a7.10 cell pair - A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A7.6 cell pair - a7.9 cell pair - b7.10 cell pair - B7.1 cell pair - B7.2 cell pair - B7.3 cell pair - B7.5 cell pair - B7.7 cell pair - B7.8 cell pair - b7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vgetal view of a 64-cell embryo stained for Otx mRNA by ISH. Expression is seen in the a6.5, b6.5 progeny (a7.9/10, b7.9/10), and several B-line blastomeres.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a7.10 cell pair - a7.9 cell pair - b7.10 cell pair - B7.1 cell pair - B7.2 cell pair - B7.3 cell pair - B7.5 cell pair - B7.7 cell pair - B7.8 cell pair - b7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Animal view of a 64-cell embryo treated with the MEK inhibitor PD184352 from the 8-cell stained for Otx mRNA by ISH. Expression is seen in the B7.8 blastomeres only.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B7.8 cell pair -

C. robusta formely Ciona int. type A, Stage 8 (64-cell)

Read more…

Vegetal view (anterior is up) of a 64-cell stage embryo electroporated with a construct that contains the cis-regulatory region of Ci-otx (-3541 bp upstream the first nucleotide of cDNA AF305499 to ATG in second exon) driving LacZ, and stained with Xgal. Staining in the a6.5, b6.5 and some B lineages, which do not express the transgene anymore, is due to the stability of LacZ. The weak nucler signal in the A-line indicates onset of expression. Unpublished data from V. Bertrand.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a7.10 cell pair - A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - a7.9 cell pair - b7.10 cell pair - B7.1 cell pair - B7.2 cell pair - B7.3 cell pair - B7.4 cell pair - B7.5 cell pair - B7.7 cell pair - B7.8 cell pair - b7.9 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) b8.29 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : A7.1, A7.2, A7.5, A7.6, B7.1, B7.2, B7.5, B7.7, B8.15, a8.17, a8.19

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - a8.17 cell pair - a8.19 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of an 110 cell stage embryo showing Ci-otx expression. Expression is found strongly throughout the endoderm precursors and weakly in mesenchyme, TVC and TLC precursors.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.5 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view of an early gastrula stage embryo (shortly after the 110-cell stage) probed for Ci-otx expression. Anterior is up. Expression is strong throughout the endoderm, mesenchyme and brain/pharynx precursors.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - a8.25 cell pair - a8.26 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Animal explant (b4.2) treated with bFGF from the 8-cell to the gastrula stage, fixed and probed for Ci-otx expression in bFGF.(only 24% positive, n=38). The small proportion of positive indicates that the b-line explant is only marginally competent to undergo anterior neural differentiation in response to FGF induction.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Animal explant (a4.2) treated with bFGF from the 8-cell to the mid gastrula stage, fixed and probed for Ci-otx expression in bFGF.(85% positive, n=46)

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Posterior animal explant (b4.2) at the early gastrula stage (shortly after 110-cell stage) probed for Ci-otx expression. This animal explant was cultured in sea water alone.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Animal explant (a4.2) at the mid gastrula stage probed for Ci-otx expression in bFGF. This animal explant was cultured in sea water alone.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of an embryo electroporated with a construct that contains a cis-regulatory region of Ci-otx (from -271 bp upstream the first nucleotide of cDNA AF305499 to 161 bp donwstream) and stained with XGal at 110 cells stage.No staining was detected. This region may include the endogenous Ci-otx minimal promoter.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of an embryo electroporated with a construct that contains the cis-regulatory region of Ci-otx (from -1417 bp upstream the first nucleotide of cDNA AF305499 to +161 pb downstream) and stained for Xgal protein at 110 cells stage. Expression is restricted to the vegetal and b6.5-line progeny of cells expressing otx at earlier stages.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - A8.5 cell pair - A8.6 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains a cis-regulatory region of Ci-otx (from -706 bp upstream the first nucleotide of cDNA AF305499 to +161 bp downstream) driving LacZ and stained with XGal. Expression is driven in the progeny of b- and B-line cells expressing Ci-otx at earlier stages. Same expression pattern as -1133+161 construct.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains the cis-regulatory region of Ci-otx (-3541 bp upstream the first nucleotide of cDNA AF305499 to ATG in second exon) driving LacZ, and stained with Xgal. Staining in the a6.5, b6.5 and some B lineages, which do not express the transgene anymore, is due to the stability of LacZ.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - A8.5 cell pair - A8.6 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Animal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains the a-element of the cis regulatory region of Ci-otx (from -1541 to -1417 bp upstream of the first nucleotide of cDNA AF305499) driving the pBra minimal promoter and LacZ. Embryos were fixed at the 110-cell stage and and stained with XGal. Due to mosaic inheritance of the plasmid, embryos are stained on the right side only. Staining is restricted to the progeny of a6.5 and b6.5.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell embryo electroporated with a construct that contains the cis-regulatory region of Ci-otx (from -3541 bp upstream of the first nucleotide of cDNA AF305499 to +161 bp downstream) driving LacZ, and stained with XGal. Some mosaicism is apparent. Staining in a, b and some A (notochord) and B (muscle) lines, in which the transgene is not expressed at this stage, is due to the stability of LacZ protein. Same expression pattern as -3541-ATG.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - A8.5 cell pair - A8.6 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of an embryo electroporated with a construct containing the cis-regulatory region of otx gene extending -1541 bp upstream the first nucleotide of cDNA AF305499 to +161 bp downstream. The embryo was stained with XGal at the 110-cell stage. This construct drives the same expression as -3541-ATG. Expression in the a-line most B-line and b-line is due to the remanence of the LacZ protein, the gene being off in these territories at this stage.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - A8.5 cell pair - A8.6 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell embryo electroporated with a construct that contains the cis-regulatory region of Ci-otx (from -2165 bp upstream of the first nucleotide of cDNA AF305499 to +161 bp downstream) driving LacZ, and stained with XGal. Some mosaicism is apparent. Staining in a, b and some A (notochord) and B (muscle) lines, in which the transgene is not expressed at this stage, is due to the stability of LacZ protein. Same expression pattern as -3541-ATG.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - A8.5 cell pair - A8.6 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell embryo electroporated with a construct that contains the cis-regulatory region of Ci-otx (from -1723 bp upstream of the first nucleotide of cDNA AF305499 to +161 bp downstream) driving LacZ, and stained with XGal. Some mosaicism is apparent. Staining in a, b and some A (notochord) and B (muscle) lines, in which the transgene is not expressed at this stage, is due to the stability of LacZ protein. Same expression pattern as -3541-ATG.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - A8.5 cell pair - A8.6 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains a cis-regulatory region of Ci-otx (from -1133 bp upstream the first nucleotide of cDNA AF305499 to +161 bp downstream) driving LacZ and stained with XGal. Expression is driven in the progeny of b- and B-line cells expressing Ci-otx at earlier stages. Same expression pattern as -1133+161 construct.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of an embryo electroporated with a construct that contains a cis-regulatory region of Ci-otx (from -271 bp upstream the first nucleotide of cDNA AF305499 to exon 2) and stained with XGal at 110 cells stage. No staining was detected. This region may include the endogenous Ci-otx minimal promoter.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains the a-pbra element of Ci-Otx (from -1541 to -1417 bp upstream the first nucleotide of cDNA AF305499 placed in front of the brachyury minimal promoter driving LacZ). Expression is detected in a6.5 and b6.5 line, plus some unclear and possibly artefactual endodermal staining.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

No picture provided. Mutation of the two ETS sites in the a-element leads to a loss of a6.5-line expression as well as to a large reduction in b6.5 line activity (from 30% of embryos in a-element to less than 5% in the mutated element).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains the mutated a-pbra element of Ci-Otx, with a mutated distal most ETS site, (from -1541 to -1417 bp upstream the first nucleotide of cDNA AF305499 placed in front of the brachyury minimal promoter driving LacZ). Expression is detected in a6.5 and b6.5 line, but at a much lower frequency than in the parental a-element (a6.5 line: 2% instead of 20%; b6.5 line: 15% instead of 30%).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains the mutated a-pbra element of Ci-Otx, with a mutated distal most ETS site, (from -1541 to -1417 bp upstream the first nucleotide of cDNA AF305499 placed in front of the brachyury minimal promoter driving LacZ). Expression is detected in a6.5 and b6.5 line, but at a slightly lower frequency than in the parental a-element (a6.5 line: 6% instead of 20%; b6.5 line: 20% instead of 30%).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Vegetal view (anterior is up) of a 110-cell stage embryo electroporated with a construct that contains the mutated a-pbra element of Ci-Otx, in which the two proximal most GATA sites were mutated GATA to TATA, (from -1541 to -1417 bp upstream the first nucleotide of cDNA AF305499 placed in front of the brachyury minimal promoter driving LacZ). Expression is detected in a6.5 and b6.5 line, but at a much lower frequency than in the parental a-element (a6.5 line: 2% instead of 20%; b6.5 line: 20% instead of 30%).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

No picture available. Embryos were electroporated with a construct that contains the mutated a-pbra element of Ci-Otx, in which the 5 distal most GATA sites were mutated GATA to TATA, placed in front of the brachyury minimal promoter driving LacZ). No Expression was detected at the 110-cell stage.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

No picture available. Embryos were electroporated with a construct that contains the a-pbra element of Ci-Otx (from -1472 to -1417 bp upstream the first nucleotide of cDNA AF305499 placed in front of the brachyury minimal promoter driving NLS-LacZ. Expression was detected in a6.5 and b6.5 line at levels only slightly lower than the complete a-element (-1541/-1417).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

No picture available. this construct contains a single copy of the 2 ETS sites of the otx a-lement, the minimal enhancer driving expression in a6.5, b6.5. Electroporation of the construct gives no LacZ staining.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

No picture available. This construct contains a dimer of the 2 ETS sites of the otx a-element, the minimal enhancer driving expression in a6.5, b6.5. Electroporation of the construct gives LacZ staining in the a6.5 and b6.5 line as well as in most vegetal cells responsive to FGF9/16/20. Only 10-20% of embryos show staining in each tissue.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.13 cell pair - A8.14 cell pair - a8.17 cell pair - a8.18 cell pair - a8.19 cell pair - a8.20 cell pair - A8.5 cell pair - A8.6 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair - B8.5 cell pair - B8.6 cell pair - B8.7 cell pair - B8.8 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

No picture available. Embryos electroporated with this construct, which harbors an internal deletion of the ETS sites in the minimal a-element (Otx -1472/-1417), show no LacZ staining.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

No picture available. Embryos electroporated with this construct, which harbors a dimer of an internal deletion of the ETS sites in the minimal a-element (Otx -1472/-1417) show b6.5-line staining in around 10% of embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) b8.17 cell pair - b8.18 cell pair - b8.19 cell pair - b8.20 cell pair -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

Embryos electroporated with a construct that contains the Ci-fog cis-regulatory region from -314bp to +1bp lacking of the firs intron and mutated for these two GATA sites. GATA sites were replaced by two GATA sites from the neural a-element of Ci-otx (Bertrand et al., 2003). This permutation maintained early-animal-wide expression.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Read more…

embryos electroporated with a construct (amEts-pfog-290 construct in the paper) containing the entire Ci-fog cis regulatory region from -290bp to the ATG. The otx neural a-element was inserted upstream of pfog with point mutation in the two Ets sites. Electroporation of this construct led to a strong animal-wide expression

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line - b line -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal view of a Ciona robusta early gastrula stage embryo probed for Otx expression and injected with a control morpholino oligo.
Otx expression is observed in a8.17, a 8.19, b8.17 and b8.19 animal blastomers and in A7.1, A7.2, A7.5, A8.11, A8.12, B7.1, B7.2, B7.5, B7.7, B8.15 and B8.12 vegetal blastomers.
n, number of embryos examined. % : Percentages of embryos with Otx expression in the neural lineage (cyan arrowheads).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - a8.17 cell pair - a8.19 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.19 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Vegetal view of a Ciona robusta early gastrula stage embryo probed for Otx expression and injected with morpholino oligos against Prdm1-r.a, Prdm1-r.b and Hes.a.
Otx is expressed in the same territories compared to the control embryo.
Original annotation: The expression of the early neural marker Otx was not lost in the brain/palp lineage of Prdm1-r.a/b/Hes.a morphants. Note that Otx expression in the brain/palp lineage appeared to be stronger in Prdm1-r.a/b/Hes.a morphants than in control embryos.
n, number of embryos examined. % : Percentages of embryos with Otx expression in the neural lineage (cyan arrowheads).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A7.1 cell pair - A7.2 cell pair - A7.5 cell pair - A8.11 cell pair - A8.12 cell pair - a8.17 cell pair - a8.19 cell pair - B7.1 cell pair - B7.2 cell pair - B7.5 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.19 cell pair -

C. robusta formely Ciona int. type A, Stage 11 (early gastrula)

Read more…

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) B7.1 cell pair - B7.2 cell pair - B7.7 cell pair - B8.15 cell pair - B8.16 cell pair - b8.17 cell pair - b8.19 cell pair - B8.6 cell pair - B9.10 cell pair - B9.13 cell pair - B9.14 cell pair - B9.15 cell pair - B9.16 cell pair - B9.9 cell pair -

C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)

Read more…

Vegetal view of a mid gastrula stage embryo probed for Ci-Otx expression.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) row III neural plate - row IV neural plate -

C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)

Read more…

Neural plate and lateral views of a mid gastrula stage wild type probed for Ci-OTX expression.

Aniseed annotation :
A weak staining might have been detected in part of the head epidermis (4 cells at the top of the embryo).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - head epidermis -

C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)

Read more…

Neural plate and lateral views of a mid gastrula stage embryo probed for Ci-OTX expression in which Nodal signalling has been blocked by incubation into the Alk4/5/7 inhibitor SB431542. The position of the neural plate was altered in SB431542-treated embryos, it remained "on top" of the embryo owing to defects in gastrulation movements associated with inhibition of Nodal signalling. Control sibling embryo shows the wild type pattern of the gene.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - head epidermis -

C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)

Read more…

Dorsal view of a mid gastrula embryo showing Ci-otx expression. Figure B shows an embryo co-stained with nuclear dye syto11 to show the position of nuclei and identify cells.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate -

C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)

Read more…

Mid gastrula stage b4.2 explant, treated with bFGF, showing loss Ci-otx expression (75% explants). Wild type embryo and untreated BSA explant, assayed for Ci-otx expression, are included.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Conversion to Aniseed format of data from Yutaka Satous gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : nervous system.
Comment : weak expression in the muscle and other tissues, which are descendants of the blastomere expressing this gene at the early gastrula stage.

Aniseed annotation :
According to the original annotation, a signal have been detected in the tail muscles and epidermis.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - A line neural plate - b line neural plate - epidermis - tail muscles -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Aniseed Comment: update of annotation of (Imai et al., 2004), based on (Imai et al., 2006).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a9.33 cell pair - a9.34 cell pair - a9.37 cell pair - a9.38 cell pair - a9.49 cell pair - a9.50 cell pair -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal view of a late gastrula probed for Ci-Otx expression following zygote electroporation with Ci-FoxA-a overexpression construct. Mosaic inheritance of the transgene lead to an ectopic expression only in one side of the embryo. Control picture of a sibling embryo show the wild type expression pattern of the gene.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) b9.33 cell pair - b9.37 cell pair - b9.38 cell pair - row III neural plate - row IV neural plate -

C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Read more…

Vegetal view of a late gastrula probed for Ci-Otx expression following zygote injection of Ci-FoxA-a morpholinos. Control sibling embryo show the wild type expression pattern of the gene. The expression is lost in experimental embryos.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

Read more…

Dorsal view, anterior to the left, of an early neurula embryo showing Ci-otx expression. The embryo is co-stained with nuclear dye syto11 to identify cell position.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

Read more…

Neural plate view of a early neurula stage wild type probed for Ci-OTX expression. One picture shows the WT expression in cleaving embryos, the other, the expression in cytochalasin arrested embryos at the 64-cell stage. Expression is detected in the whole a-line neural plate as well as in the A7.4 (medial) derivatives of the neural plate.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A10.25 cell pair - A10.26 cell pair - A10.27 cell pair - A10.28 cell pair - A10.29 cell pair - A10.30 cell pair - A10.31 cell pair - A10.32 cell pair - a line neural plate -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

Read more…

Neural plate view of a late gastrula stage embryo probed for Ci-OTX expression following egg micro-injection of a Nodal-MO. Nodal signalling is inhibited. Control sibling embryo shows the wild type pattern of the gene. Insert of the control sibling embryo shows a control cleaving embryos for Ci-OTX expression. Cell division was blocked by cytochalasin B, gene expression profile corresponds to the stage observed.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - A line neural plate -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

Read more…

Vegetal pole view of a cleavage arrested early neurula in which the b6-5 blastomere was ablated on the right side at the 32-cell stage and probed for Ci-OTX expression.

Control arrested sibling embryo shows the wild type pattern of the gene. Insert of the control sibling embryo shows a control cleaving embryos for Ci-OTX expression. Cell division was blocked by cytochalasin B, gene expression profile was at the equivalent of the late neurula to the stage observed.

In the b6.5 ablated embryos, staining was extended to the derivatives of A7.8 to cover the whole A-line neural plate. To simplify data mining, the pattern is described as if both b6.5 cells had ben ablated.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - A line neural plate -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

Read more…

Vegetal view of a late gastrula stage embryo probed for Ci-Otx expression in which Nodal signalling has been blocked by incubation in SB431542 which inhibits the Alk4/5/7 type 1 nodal receptor. Inhibition of Nodal signalling leads to a lateral extension of Otx which now covers the whole A-line neural plate including 47.8 derivatives. Control sibling embryo shows the wild type pattern of the gene. Insert of the control sibling embryo shows a control cleaving embryos for Ci-Otx expression. Cell division was blocked by cytochalasin B, gene expression profile corresponds to the stage observed.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - A line neural plate -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : nervous system, epidermis.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) head epidermis - neural plate -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Mid neurula stage wild type embryo probed for Ci-Otx expression.

Ci-Otx was expressed in the neural tissue precursors.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) neural plate -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Mid neurula stage embryos probed for Ci-Otx expression following the injection of Ci-Rga-MO.

Ci-Otx expression was lost or reduced (for 24% and 76% of embryos respectively) in the neural tissue precursors.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Dorsal view of a neurula stained for Otx mRNA by ISH. Expression is detected throughout the a-line neural plate and in the medial (A7.4-derived) rows of the A-line neural plate.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A10.25 cell pair - A10.26 cell pair - A10.27 cell pair - A10.28 cell pair - A10.29 cell pair - A10.30 cell pair - A10.31 cell pair - A10.32 cell pair - a line neural plate -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Animal caps cultured until the mid neurula stage in the presence of 2 micromolar of the MEK inhibitor PD184352 and 100ng/ml bFGF and probed for Otx expression. No expression was detected, indicating that the PD treatment blocked response of cells to FGF.

Control 3: Animal caps cultured until the mid neurula stage in the presence of 2 micromolar of the MEK inhibitor PD184352 and probed for Otx expression. No expression was detected.

Control 1: Animal caps cultured until the mid neurula stage and probed for Otx expression. No expression was detected.

Control 2: Dorsal view of a neurula stained for Otx mRNA by ISH. Expression is detected throughout the a-line neural plate and in the medial (A7.4-derived) rows of the A-line neural plate.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Dorsal view of a neurula stained for Otx mRNA by ISH. Expression is detected throughout the a-line neural plate and in the medial (A7.4-derived) rows of the A-line neural plate. The cytochalasin-treated cleavage arrested embryos demonstrate that only the progeny of A7.4 is labelled in the A-line neural plate. D: animal view; H: vegetal view.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A10.25 cell pair - A10.26 cell pair - A10.27 cell pair - A10.28 cell pair - A10.29 cell pair - A10.30 cell pair - A10.31 cell pair - A10.32 cell pair - a line neural plate -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

views of neurulae (either cleaving or cytochalasin-arrested) from embryos treated with the MEK inhibitor PD184352 from the 8 cell stage and stained for Otx mRNA by ISH at the mid neurula stage. In most cases (3/4 experiments), expression in a-line was absent or much reduced, A-line expression was extended to the A7.8 derivatives to cover the whole A-line neural plate, and also extended to the notochord (and in some cases, to the anterior endoderm).

The article also shows results of first DiI tracing of A7.4 and A7.8 followed by ISH with Otx probe. this experiment, not entered into Aniseed, confrims that in PD-treated embryos, all A-line neural plate cells now express Otx.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) A line neural plate - notochord -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Animal caps cultured until the mid neurula stage and probed for Otx expression. No expression was detected.

Control: Dorsal view of a neurula stained for Otx mRNA by ISH. Expression is detected throughout the a-line neural plate and in the medial (A7.4-derived) rows of the A-line neural plate.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Animal caps cultured until the mid neurula stage in the presence of 2 micromolar of the MEK inhibitor PD184352 and probed for Otx expression. No expression was detected.

Control 1: Animal caps cultured until the mid neurula stage and probed for Otx expression. No expression was detected.

Control 2: Dorsal view of a neurula stained for Otx mRNA by ISH. Expression is detected throughout the a-line neural plate and in the medial (A7.4-derived) rows of the A-line neural plate.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Read more…

Animal caps cultured until the mid neurula stage in the presence of 100ng/ml bFGF and probed for Otx expression. expression was induced throughout the animal explant, indicating that otx is a target of FGF.

Control 1: Animal caps cultured until the mid neurula stage and probed for Otx expression. No expression was detected.

Control 2: Dorsal view of a neurula stained for Otx mRNA by ISH. Expression is detected throughout the a-line neural plate and in the medial (A7.4-derived) rows of the A-line neural plate.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - epidermis -

C. robusta formely Ciona int. type A, Stage 16 (late neurula)

Read more…

Late neurula embryos showing Ci-otx expression in a line neural plate and anterior epidermis. Figures A. and B. dorsal view and figure C. lateral view.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) a line neural plate - row II neural plate -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : epidermis.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior dorsal midline head epidermis (a8.26 line) - anterior sensory vesicle - anterior ventral head epidermis (a7.11 line) - central dorsal midline head epidermis (a7.14 line) - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Two-color fluorescence WISH was performed at the early tailbud stage. Otx expression is shown in red, Pax2/5/8 in green.

Original annotation:
Ci-Otx is expressed in the sensory vesicle, neurohypophysis primordium, palps and pharynx. Ci-Pax2/5/8a is expressed just posterior to the Ci-Otx expression domain.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the early tailbud stage. Otx expression is shown in red, Hox1 in green.

Original annotation:
Ci-Otx is expressed in sensory vesicle, palps, neurohypophysis primordium and pharynx. The first domain of Ci-Hox1 is also just behind the Ci-Otx domain without any gap.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the early tailbud stage (named stage Tr:Ta=1:1 in the paper). Otx expression is shown in red, Ci-En in green.

Original annotation:
Ci-Otx is expressed in sensory vesicle, palps, neurohypophysis primordium and pharynx. The posterior boundaries of the first Ci-En domain and the Ci-Otx domain coincide exactly.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Dorsal view of an early tailbud wild type embryo probed for Otx expression.
Red and yellow arrowheads indicate boundaries between the neck and the visceral ganglion, and between the visceral ganglion and the caudal nerve cord, respectively.

Original Annotation :
Otx was expressed in A11.64 and A11.63 cell pairs ( posterior sensory vesicle).

Aniseed Annotation :
According to the picture, it seems that there is also expression in the anterior sensory vesicle.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Dorsal view of an early tailbud stage embryo probed for Otx expression, following the injection of FGF8/17/18 MO (FGF8/17/18-2nd MO (Imai 2009)). Note that two FGF8/17/18 MOs were used in this article (in Aniseed FGF8/17/18-MO (Imai 2009) and FGF8/17/18-2nd MO (Imai 2009)).
Red and yellow arrowheads indicate boundaries between the neck and the visceral ganglion, and between the visceral ganglion and the caudal nerve cord, respectively.

Original Annotation :
Ectopic expression is observed in the neck (black arrow).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neck - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Dorsal view of an early tailbud stage embryo probed for Otx expression, following the injection of FGF8/17/18 MO (FGF8/17/18-MO (Imai 2009)). Note that two FGF8/17/18 MOs were used in this article (in Aniseed FGF8/17/18-MO (Imai 2009) and FGF8/17/18-2nd MO (Imai 2009)).
Red and yellow arrowheads indicate boundaries between the neck and the visceral ganglion, and between the visceral ganglion and the caudal nerve cord, respectively.

Original Annotation :
Ectopic expression is observed in the neck (black arrow).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neck - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Dorsal view of an early tailbud stage wild type embryo probed for Ci-otx expression.
The insert shows in red cells from the posterior sensory vesicle (PSV) and light-blue cells from the middle part of the visceral ganglion (VG). Broken white lines indicate the boundaries of the PSV/neck and the neck/VG.

Original Annotation :
Ci-otx expression was detected only in A11.64 and A11.63 cell pairs (posterior sensory vesicle) in addition to the anterior sensory vesicle.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Dorsal view of an early tailbud stage embryo probed for Ci-otx expression, following the injection of FGF8/17/18 MO.
The insert shows in red cells from the posterior sensory vesicle (PSV) and light-blue cells from the middle part of the visceral ganglion (VG). Broken white lines indicate the boundaries of the PSV/neck and the neck/VG.

Original Annotation :
Ectopic expression was detected in A11.62 and A11.61 cell pairs (neck).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neck - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Dorsal and lateral views, anterior to left, of mid tailbud embryo showing Ci-Otx expression in dorsal anterior epidermis, throughout the anterior sensory vesicle and part of the posterior sensory vesicle.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Animal explant treated with bFGF showing expression of Ci-otx and altered morphology.bFGF-treated explants appeared more compact and had striking bumps and protusions.These morphological changes were accompanied by induction of Ci-otx expression in half of the explant (a)line) and were dose-dependent, occuring more frequently with increasing doses of bFGF (1ng/ml bFGF: expression in 10% of explants; 10ng/ml: 60%; 100ng/ml: 100% of explants).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - head epidermis - neurohypophysis primordium -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Lateral view of an early tailbud stage embryo probed for Otx and En expression.

Original annotation:
The anterior expression domain of Ci-En corresponds to the most posterior region of the brain that is marked by Ci-Otx.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Lateral view of an early tailbud stage embryo probed for Otx and FgfL expression.

Original annotation :
Ci-FgfL, whose product was not asigned to any vertebrate FGFs, is expressed in the middle of the Ci-Otx domain.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Posterior half (B4.1 and b4.2) explant grown to the late tailbud stage and probed for Ci-otx expression. The explants showed no expression of Ci-otx (98% negative, n=111).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Animal half (a 4.2 + b4.2) of a late tailbud stage embryo probed for Ci-otx expression in bFGF. In this case, this animal explant was cultured in sea water alone and have a rounded,disc-shape morphology.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

Anterior half explant (A4.1 and a4.2) cultured to the early tailbud stage and probed for Ci-otx expression. 78% positive, n=45.The authors found that a large area was induced to express Ci-otx in a manner strikingly similar to that observed in whole embryo.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - head epidermis - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

B4.1+a4.2 recombinate, grown to the early tailbud stage and probed for Ci-otx expression. Ci-otx was strongly induced in 11% (n=95) of cases with further 20% showing a small patch of expression.

This shows that the B-line has a lower anterior neural tissue inducing potential than the A-line.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Read more…

A4.1 with b4.2 recombined at the 8-cell stage, left to develop until the early tailbud stage, and probed for Ci-otx expression. Strong Ci-otx was observed in 28% (n=86) of cases with a further 19% showing a small patch of expression.

This experiment shows that the b4.2 blastomere is less competent that the a4.2 one to form anterior neural tissue in response to A-line mediated neural induction.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

A mid tailbud wild type probed for Ci-otx expression.

Original Annotation : Otx was expressed in the nervous system.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) central nervous system -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

A mid tailbud probed for Ci-otx expression following the injection of Ci-Mras MO1.

Original Annotation : Otx was still expressed in the nervous system but the embryo was deformed.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) central nervous system -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Aniseed Comment: update of annotation of (Imai et al., 2004), based on (Imai et al., 2006).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior dorsal midline head epidermis (a8.26 line) - central dorsal midline head epidermis (a7.14 line) - dorso lateral head epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :Otx.
Expression pattern : epidermis.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior dorsal midline head epidermis (a8.26 line) - anterior sensory vesicle - dorso lateral head epidermis - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the mid tailbud stage. Otx expression is shown in red, Pax2/5/8a in green.

Original annotation:
Ci-Otx is expressed in sensory vesicle, neurohypophysis primordium, palps and pharynx. The expression domain of Ci-Pax2/5/8a is still adjoining the Ci-Otx domain.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the mid tailbud stage. Otx expression is shown in red, Hox1 in green.

Original annotation:
Ci-Otx is expressed in sensory vesicle, neurohypophysis primordium, pharynx and Palps. There is a gap between the Ci-Otx domain and the first domain of Ci-Hox1.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the mid tailbud stage (named stage Tr:Ta=1:2 in the paper). Otx expression is shown in red, En in green.

Original annotation:
Ci-Otx is expressed in sensory vesicle, neurohypophysis primordium, pharynx and palps. The expression pattern of Ci-En has dramatically altered by this stage. Ci-En is expressed in three domains aligned along A-P axis. Interestingly, none of these domains overlaps with the Otx domain.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Mid tailbud stage a4.2 explant, treated with bFGF, showing induced Ci-otx expression in 93% of explants. Wild type embryo and untreated BSA explant, assayed for Ci-otx expression, are included.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) whole embryo -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid tailbud stage embryo probed for Ci-otx expression. expression is detected in the sensory vesicle, and anterior epidermis and oral siphon primorpdium (+palps??).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Mid tailbud stage A4.1/B4.1 explant showing weak Ci-otx expression (91% explants). Expression may represent residual expression in anterior endoderm from A4.1 derivatives as isolated B4.1 explants show no Ci-otx expression. Wild type embryo, assayed for Ci-otx expression, is included.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior head endoderm -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Animal explant (b4.2) grown to the mid tailbud stage and probed for Ci-otx expression.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Mid tailbud stage a4.2/b4.2 explant showing loss of Ci-otx expression (98% explants). Wild type embryo, assayed for Ci-otx expression, is included.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Mid tailbud stage b4.2 explant, treated with bFGF, showing absence of Ci-otx expression in 90% of explants.
Wild type embryo and untreated BSA explant controls, assayed for Ci-otx expression, are included.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Vegetal half explant at the late tailbud stage probed for otx expression. Rare expression in A4.1 derivatives (9%) may represent residual expression obscured by the neural expression in whole embryos

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Animal explant (a4.2) cultured to the late tailbud stage embryo and probed for Ci-otx. No expression detected in 92% of explants.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

lateral view of an embryo electroporated with a construct that contains a cis-regulatory region of Ci-otx (from -271 bp upstream the first nucleotide of cDNA AF305499 to 161 bp donwstream) and stained with XGal at the mid tailbud stage. weak staining in the mesenchyme and a few muscle cells is detected. Unpublished results from V. Bertrand.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) primary muscle lineage -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid-tailbud embryo electroporated with pOtx -3541/+1333::NLS-LacZ and hybridised with a LacZ in situ probe. Expression is detected in part of the endoderm, in the anterior sensory vesicle, and in the palps and anterior epidermis and in part of the posterior endoderm. Unpublished data by V. Bertrand.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - anterior ventral head epidermis (a7.11 line) - posterior ventral head endoderm -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

Lateral view of a mid-tailbud embryo electroporated with pOtx -3541/+161::NLS-LacZ and hybridised with a LacZ in situ probe. Expression is detected in the posterior endoderm and in the anterior sensory vesicle. Unpublished data by V. Bertrand.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - posterior ventral head endoderm -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Read more…

The region extending from -271bp to exon 2 of Otx drives late expression in the palps, part of the anterior epidermis and sensory vesicle. Unpublished results from V. Bertrand.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - anterior ventral head epidermis (a7.11 line) - dorso lateral head epidermis -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Late tailbud embryo probed for Ci-Otx expression (in blue), Ci-Eph3 expression (in green) and Ci-En expression (in red).

Aniseed annotation:
Otx was expressed in the sensory vesicle, the visceral ganglion, the neurohypophysis primordium, and the pharynx.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle - ventral VG ependymal cells -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Late tailbud embryo probed for Ci-Otx expression (in blue), Ci-Eph3 expression (in green) and Ci-En expression (in red) following the injection of Ci-Hox1-MO.

Aniseed annotation:
Expression of Ci-Otx unaffected.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle - ventral VG ependymal cells -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the late tailbud stage. Otx expression is shown in red, Hox1 in green.

Original annotation: Ci-Otx expression extends caudally along the ventral midline of the neural tube.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle - ventral TNC ependymal cells (keel cells) - ventral VG ependymal cells -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the late tailbud stage. Otx expression is shown in red, Pax 2/5/8a in green.

Original annotation:
Ci-Otx is expressed in neurohypophysis primordium, pharynx, sensory vesicle and palps and extends caudally along the ventral midline of the neural tube. Ci-Pax 2/5/8a domain anteriorly abuts the Ci-Otx domain.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle - ventral TNC ependymal cells (keel cells) - ventral VG ependymal cells -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Two-color-fluorescence WISH was performed at the late tailbud stage. Otx expression is shown in red, en in green.

Original annotation:Ci-Otx is expressed in neurohypophysis primordium, pharynx, sensory vesicles and palps and extends caudally along the ventral midline of the neural tube. Expression of Ci-En was detected in three domains. The first domain is located immediately posterior to the Ci-Otx.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - neurohypophysis primordium - posterior sensory vesicle - ventral VG ependymal cells -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Lateral view, anterior to left, of late tailbud embryo showing Ci-otx expression in sensory vesicle and weaker expression in anterior epidermis

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior dorsal midline head epidermis (a8.26 line) - anterior sensory vesicle - anterior ventral head epidermis (a7.11 line) - central dorsal midline head epidermis (a7.14 line) - neurohypophysis primordium - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Lateral view of the anterior region of a late tailbud embryo showing otx expression in the sensory vesicle.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) anterior sensory vesicle - posterior sensory vesicle -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Read more…

Lateral view of late a tailbud embryo showing continued expression after inhibition of MEK signalling by PD184352 treatment at the 8 cell stage. Expression is lost from the a line epidermis and maintained in the A line cells. Expression is probably found throughout both the A7.4 and A7.8 lineages as a result of the conversion of the visceral ganglion and nerve cord into a posterior sensory vesicle identity.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) neck - posterior sensory vesicle - tail nerve cord - visceral ganglion -

C. robusta formely Ciona int. type A, Stage 24 (late tailbud II)

Read more…

This reporter construct shows no activity in Ciona intestinalis late tailbuds.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) No expression -

C. robusta formely Ciona int. type A, Stage 26 (hatching larva)

Read more…

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s) endoderm - epidermis - tail muscles -

C. robusta formely Ciona int. type A, Stage 27 (swimming larva I)

Read more…

Lateral view of the head of a WT Ciona robusta swimming larva probed for Otx expression.
Otx is only expressed in the sensory vesicle.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 27 (swimming larva I)

Read more…

Lateral view of the head of a WT Ciona robusta swimming larva probed for Otx expression and electroporated with Titf>Hox1-TALEN. This overexpression construct is used to target the Hox1 locus in the endodermal tissue.
Otx is only expressed in the sensory vesicle.
Scale bar: 50 µm.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 39 (Hotta stage 39)

Read more…

6 days post fertilization WT Ciona robusta juvenile probed for Otx expression. The second image is the magnified posterior tip of the endostyle of another embryo.
Otx is expressed in the anterior endostyle (black arrow).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 39 (Hotta stage 39)

Read more…

6 days post fertilization Ciona robusta juvenile probed for Otx expression and electroporated with Titf>Hox1-TALEN. This overexpression construct is used to target the Hox1 locus in the endodermal tissue. The second image is the magnified posterior tip of the endostyle of another embryo.
Otx is expressed in the anterior endostyle, as in WT conditions (black arrow), but also in the posterior endostyle (red arrow).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 39 (Hotta stage 39)

Read more…

6 days post fertilization Ciona robusta juvenile probed for Otx expression and electroporated with Titf>Otx-TALEN. This overexpression construct is used to target the Otx locus in the endodermal tissue.
Otx expression in the anterior endostyle is lost (white arrow).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 39 (Hotta stage 39)

Read more…

6 days post fertilization Ciona robusta juvenile probed for Otx expression and co-electroporated with Titf>Otx-TALEN and Titf>Hox1-TALEN. These overexpression constructs are used to target Otx and Hox1 loci in the endodermal tissue.
Otx is expressed in the anterior endostyle, as in WT conditions (black arrow), but also in the posterior endostyle (red arrow).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 39 (Hotta stage 39)

Read more…

6 days post fertilization Ciona robusta juvenile probed for Otx expression and electroporated with Titf>Hox1. This construct is used to overexpress Hox1 in the endodermal tissue.
Otx expression in the anterior endostyle is lost (white arrow).

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 39 (Hotta stage 39)

Read more…

WT Ciona robusta 6 days post fertilization juveniles probed for Otx expression. The second image is the magnified posterior tip of the endostyle of another embryo.
Otx is expressed in the anterior tip of the endostyle (black arrow).
Numbers indicate the proportion of juveniles showing the phenotype represented by the panel.
Scale bar: 50 µm.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)

C. robusta formely Ciona int. type A, Stage 39 (Hotta stage 39)

Read more…

Ciona robusta 6 days post fertilization juvenile probed for Otx expression and electroporated with Musashi>Hox1-TALEN. This overexpression construct is used to target the Hox1 locus in the endostyle of juveniles.
Otx is expressed in the anterior tip of the endostyle (black arrow), as in WT conditions, but also in its posterior tip (red arrow).
Numbers indicate the proportion of juveniles showing the phenotype represented by the panel.
Scale bar: 50 µm.

Stained molecule KH2012:KH.C4.84 (CRX; OTX1; OTX2)
Stained region(s)