Oocytes of a single individual of Ciona intestinalis (Roscoff, France) were fertilized by a mixture of sperm of two individuals and development was followed microscopically. Embryos were snapfrozen in liquid nitrogen at the appropriate stage and kept at -80°C. Samples at stage 0, 8, 12, 15, 21, 26 were collected from the same fertilzation, while sample from stage 11 was independently collected from a different individual. Total RNA was prepared with the RNA II kit of Magerey Nagel and the quality was checked with the Bioanalyzer, all samples had a RIN value of higher than 9. Strand specific libraries were constructed and the sequencing (50PE) was performed with Illumina HiSeq 2000 technology (BGI, Hong Kong, China). Reads were aligned onto C.robusta genome and considered to reflect the expression of the C.robusta orthologous genes.

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : No signal was detected

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : No distinct zygotic signal was detected

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : No distinct zygotic signal was detected

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : b7.9, b7.10.

110-cell stage embryo probed for Msxb expression.

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : b8.17, b8.18, b8.19, b8.20

Vegetal view of a WT 64-cell stage embryo probed for Ci-Msxb expression. expression is detected in b8.17, b8.18, b8.19, b8.20

Animal view with anterior to the top of a 112-cell stage embryo (stage 10) stained with Msxb. In the panel, anterior ectoderm in white, posterior ectoderm in yellow and gene expression in blue. Expression was observed in the b8.17, b8.18, b8.19 and b8.20 cell pairs.

Vegetal view with anterior to the top of a 112-cell stage embryo (stage 10) stained with Msxb after injection of a control morpholino. In the panel, anterior ectoderm in white, posterior ectoderm in yellow and gene expression in blue. Expression was observed in the b8.17, b8.18, b8.19 and b8.20 cell pairs.

Animal view, anterior to the top, of a 10-stage embryo stained with Msxb. Expression was observed in the b8.17, b8.18, b8.19 and b8.20 cell pairs.

“Nkx-C was expressed in the dorsal trunk epidermis midline.”

Animal view of Msxb at early gastrula stage. Original annotation : Msxb is expressed in the four daughter cells of the b6.5 blastomere.

Animal view with anterior to he top of an early gastrula stage embryo stained with Msxb. Expression was observed in the b8.17, b8.18, b8.19 and b8.20 cell pairs.

Late gastrula stage wild type embryo probed for Msxb expression. No picture available in the article.

Original Annotation :
MsxB was expressed in b9.37 and b9.38 cell pairs.

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord."

Vegetal view of a WT Ciona robusta mid gastrula embryo electroporated with Msx>LacZ (red) and probed for snail expression (green). The dashed area is enlarged in a′.
Scale bar, 25 μm

Aniseed Comment : update of annotation of (Imai et al.,2004), based on (Imai et al.,2006).

Conversion to Aniseed format of data from Yutaka Satous gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : nervous system.
Comment : b9.34, b9.37, b9.38.

Vegetal view of a mid gastrula stage wild type embryo probed for Msxb expression.

Original annotation: Msx was not expressed in the ventral ectoderm at the late-gastrula stage, and began to be expressed in the posterior half of the ventral tail ectoderm at the neurula stage. Ventral and lateral views of the embryo.

Vegetal view of a WT Ciona robusta 6-row neural plate stage embryo probed for Msxb expression and counterstained with DAPI. Medial columns 1 and 2 of neural plate row II are dividing.
Msxb expression is observed in a9.49, b9.38 and b9.37 blastomers.
In the drawing, Msxb expression is indicated by black dots, with weaker expression represented by grey dots. The a-lineage neural plate cells that generate the CNS are coloured in red.

Vegetal view of a WT Ciona robusta 6-row neural plate stage embryo probed for Msxb expression.
Msxb expression is observed in a9.49 (column 3 of neural plate row III, pink arrowhead), b9.37 and b9.38 blastomers and in the dorsal midline epidermis.
n=total number of embryos analysed.
Second image is a HD picture of the same embryo.

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord."

Dorsal view of a WT Ciona robusta late gastrula embryo electroporated with Msx>nls::LacZ (green) and probed for Neurogenin (C6.129) expression (magenta).
LacZ signalling is observed in the neural plate border.
Original annotation : In situ hybridization for Neurog (magenta) in an embryo electroporated with Msx>nls::lacZ plasmid (immunolabelling of β-galactosidase in green). White arrowhead, Msx+/Neurog+ BTN progenitor. Dashed arrowhead, transient Neurog expression in BTN progenitor’s sister cell (epidermal progenitor). Dashed line, midline. Scale bar, 25 μm.

First picture : Vegetal view of a WT Ciona robusta late gastrula embryo electroporated with Msx>Kaede::NLS. The reporter gene is targeted to nuclei (NLS:LacZ). Scale bar, 50 μm
Reporter gene is observed in the dorsal midline head and anterior tail epidermis precursors.
Second picture : Photoconversion of Kaede::nls driven by the Msx driver was used to follow the cell divisions of the BTN progenitors from the late gastrula stage to the early tailbud stage. Both b10.71 and b10.72 divide once. b11.141 will later divide again to give rise to a definitive anterior bipolar tail neuron. Numbers in each panel represent time in minutes elapsed from the initial photoconversion event.

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : epidermis.

Original annotation: Msx began to be expressed in the posterior half of the ventral tail ectoderm at the neurula stage. Ventral view and lateral view are shown. Aniseed annotation: It seems that there is also expression in the brain (A line neural plate) and dorsal tail epidermis.

Dorsal and lateral view of a mid-neurula stage embryo electroporated with a LacZ transgene containing the -3,8kb to the +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith and ocellus (op), in the neural fold (nf), in the ventral epidermis (e) and ectopically in mesoderm cells (m).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -3804bp/227bp

Aniseed annotation :
Precursors of otolith and ocellus are a10.97, a10.98 and a10.99 cell pairs.
Neural fold could be tail nerve cord precursors: b10.73, b10.74, A10.25, A10.29, A10.30, A10.57, A10.58 cell pairs.
Mesoderm cells could be muscle cells.

Neurula stage embryo electroporated with a LacZ transgene containing the -2,5kb to the +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith and ocellus , in the neural fold, in the neural tube and in the ventral epidermis. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -2545bp/227bp

Aniseed annotation :
Precursors of otolith and ocellus are a10.97, a10.98 and a10.99 cell pairs.
Neural fold/neural tube could be tail nerve cord precursors: b10.73, b10.74, A10.25, A10.29, A10.30, A10.57, A10.58 cell pairs.
There is no information concerning the staining in the mesoderm cells (compare to wild type expression).

Neurula stage embryo electroporated with a LacZ transgene containing the -818bp to the +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith and ocellus , in the neural fold and in the neural tube. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -830bp/227bp

Aniseed annotation :
Precursors of otolith and ocellus are a10.97, a10.98 and a10.99 cell pairs.
Neural fold/neural tube could be tail nerve cord precursors: b10.73, b10.74, A10.25, A10.29, A10.30, A10.57, A10.58 cell pairs.
There is no information concerning the staining in the mesoderm cells (compare to wild type expression).

Neurula stage embryo electroporated with a LacZ transgene containing the -457bp to the +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith and ocellus , in the neural fold and in the neural tube. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -469bp/227bp

Aniseed annotation :
Precursors of otolith and ocellus are a10.97, a10.98 and a10.99 cell pairs.
Neural fold/neural tube could be tail nerve cord precursors: b10.73, b10.74, A10.25, A10.29, A10.30, A10.57, A10.58 cell pairs.
There is no information concerning the staining in the mesoderm cells (compare to wild type expression).

Lateral view of a mid neurula stage embryo electroporated with a LacZ transgene containing the -227 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith and ocellus, in the neural tube, and ectopically in mesoderm cells. Expression is lost in the ventral epidermis (op, otolith-ocellus precursor; nf, neural fold; m, mesoderm cells).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -239bp/227bp

Aniseed annotation :
Precursors of otolith and ocellus are a10.97, a10.98 and a10.99 cell pairs.
Neural fold could be tail nerve cord precursors: b10.73, b10.74, A10.25, A10.29, A10.30, A10.57, A10.58 cell pairs.
Mesoderm cells could be muscle cells.

Dorsal view of a mid neurula stage embryo electroporated with a LacZ transgene containing the -117 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is lost.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -129bp/227bp

Lateral and dorsal view of a mid-neurula stage embryo electroporated with a LacZ transgene containing the N3 motif sequence tagcagcgccggcttcgcACTggttcagca in 5' of the -117bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith and ocellus (op),in the neural fold (nf) and in the mesoderm cells (m).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -129bp/227bp

Aniseed annotation :
Precursors of otolith and ocellus are a10.97, a10.98 and a10.99 cell pairs.
Neural fold could be tail nerve cord precursors: b10.73, b10.74, A10.25, A10.29, A10.30, A10.57, A10.58 cell pairs.
Mesoderm cells could be muscle cells and mesenchyme cells.

Neurula stage embryo electroporated with a LacZ transgene containing the +130 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is lost. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : 119bp/227bp

Neurula stage embryo electroporated with a LacZ transgene containing two N3 (atcgtcgcggccgaagcgtgaccaagtcgt) tandem repeats upstream the +130bp to the +238bp of the 5 flanking Ci-msxb enhancer sequence. Expression is observed in mesoderm cells. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : 119bp/227bp

Aniseed annotation :
There is no information concerning the staining in the mesoderm cells: tail muscle and/or mesenchyme?

Neurula stage embryo electroporated with a LacZ transgene containing two tandem repeats of the mutated N3 motif sequence atcgtcgcggccgaagcgTGAccaagtcgt -> atcgtcgcggccgaagcgCAGccaagtcgt in 5 of the +130bp to the +238bp of the 5 flanking Ci-msxb enhancer sequence. Expression is observed only in the head mesenchyme. Expression is lost in the sensory vesicle and in the neck/visceral ganglion. No picture available on the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : 119bp/227bp

Neurula stage embryo electroporated with a LacZ transgene containing the -457 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence with an internal deletion between -205 bp to +130 bp. No staining is detected. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -469bp/227bp delta -217bp/+118bp

Picture 1 :
Lateral view of a mid-neurula stage embryo electroporated with a LacZ transgene containing two tandem repeats of the mutated N3 motif sequence (atcgtcgcggccgaagcgTGAccaagtcgt -> atcgtcgcggccgaagcgCAGccaagtcgt) in 5 of the -117bp to the +238bp of the 5 flanking Ci-msxb enhancer sequence. Expression is observed in mesodermal territories but expression in the nervous system is lost.

Picture 2 :
Dorsal view.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -129bp/227bp

Lateral view of the late neurula stage embryo probed for msxb expression. Whole embryos were treated with BSA between the eight-cell and early 32-cell stages.

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord (Ai–ii)"

Picture 1 :
Dorsal view of a early tailbud stage embryo electroporated with a LacZ transgene containing the -227 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence with an internal deletion between -84 bp to +130 bp. Expression is observed in the precursors of otolith and ocellus, in the neural tube, and ectopically in mesoderm cells. Expression is lost in the ventral epidermis (op, otolith-ocellus precursor; nt, neural tube; nf, neural fold; m, mesoderm cells).

Picture 2 :
Lateral view.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -239bp/227bp delta -96bp/+118bp

Aniseed annotation :
Precursors of otolith and ocellus are a10.97, a10.98 and a10.99 cell pairs.
Neural fold/neural tube could be tail nerve cord precursors: b10.73, b10.74, A10.25, A10.29, A10.30, A10.57, A10.58 cell pairs. According to the picture, it seems that other cells of the neural plate are stained.

Original annotation:At the initial-tailbud stage, Msx was expressed in the entire ventral region of the tail ectoderm.

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord (Ai–ii)"

Aniseed Comment : update of annotation of (Imai et al.,2004), based on (Imai et al.,2006).

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : epidermis.

Original annotation: Msxb expression in the ventral and dorsal tail epidermis. Lateral view of the embryo is shown.

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord and various domains of the sensory vesicle, and around the palp forming region.”

Lateral view of a tailbud stage embryo electroporated with a lacZ transgene containing the -3,8kb to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith, ocellus (op), in the neural tube (nt), the ventral epidermis (e) and ectopically in mesoderm cells (m).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -3804bp/227bp

Aniseed annotation:
According to the Aniseed anatomical dictionary, the otolith-ocellus precursors correspond to pigment cell equivalence group.
Staining is also detected in the visceral ganglion and in the dorsal posterior sensory vesicle.

Tailbud embryo electroporated with a lacZ transgene containing the -2,5kb to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursor of otolith, ocellus, in the neural fold, in the neural tube and in the ventral epidermis. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -2545bp/227bp

Aniseed annotation:
According to the Aniseed anatomical dictionary, the otolith-ocellus precursors correspond to pigment cell equivalence group.
No information concerning expression in the visceral ganglion, in the dorsal posterior sensory vesicle and in muscle cells (compare to wild type expression).

Tailbud embryo electroporated with a lacZ transgene containing the -818bp to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith, ocellus, in the neural fold and in the neural tube. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -830bp/227bp

Aniseed annotation:
According to the Aniseed anatomical dictionary, the otolith-ocellus precursors correspond to pigment cell equivalence group.
No information concerning expression in the visceral ganglion, in the dorsal posterior sensory vesicle and in the muscle cells (compare to wild type expression).

Tailbud embryo electroporated with a lacZ transgene containing the -457bp to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursor of otolith, ocellusn in the neural fold and in the neural tube. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -469bp/227bp

Tailbud embryo electroporated with a lacZ transgene containing the -457bp to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the precursors of otolith and ocellus, in the neural fold and in the neural tube. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -469bp/227bp

Aniseed annotation:
According to the Aniseed anatomical dictionary, the otolith-ocellus precursors correspond to pigment cell equivalence group.
No information concerning expression in the visceral ganglion, in the dorsal posterior sensory vesicle and in the muscle cells (compare to wild type expression).

Lateral view of an early tailbud stage embryo electroporated with a LacZ transgene containing the -227 bp to the + 238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in in the precursors of otolith and ocellus, in the neural tube, and ectopically in mesoderm cells. Expression is lost in the ventral epidermis (op, otolith-ocellus precursor; nt, neural tube; m, mesoderm cells).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -239bp/227bp

Aniseed annotation:
According to the Aniseed anatomical dictionary, the otolith-ocellus precursors correspond to pigment cell equivalence group.
Staining is also detected in the visceral ganglion and in the dorsal posterior sensory vesicle.

Lateral view of an early tailbud embryo electroporated with a LacZ transgene containing the -117 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is lost.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -129bp/227bp

Tailbud stage embryo electroporated with a LacZ transgene containing the -457 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence with an internal deletion between -205 bp to +130 bp. No staining is detected. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -469bp/227bp delta -217bp/+118bp

Lateral view of a early tailbud stage embryo electroporated with a LacZ transgene containing the -227 bb to the +238 bp of the 5' flanking Ci-msxb enhancer sequence with an internal deletion between -84 bp to +130 bp. Expression is observed in the precursor of otolith and ocellus, in the neural tube, and ectopically in mesoderm cells. Expression is lost in the ventral epidermis (op, otolith-ocellus precursor; nt, neural tube; m, mesoderm cells).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -239bp/227bp delta -96bp/+118bp

Aniseed annotation:
According to the Aniseed anatomical dictionary, the otolith-ocellus precursors correspond to pigment cell equivalence group.
Staining is also detected in the visceral ganglion and in the dorsal posterior sensory vesicle.

Tailbud embryo electroporated with a LacZ transgene containing the +130 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is lost. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : 119bp/227bp

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord and various domains of the sensory vesicle, and around the palp forming region.”

Picture 1 : dorsal view Picture 2 : ventral view of a mid tail bud stage wild type embryo probed for msxb expression.

Conversion to Aniseed format of data from Yutaka Satou's gene expression profiles of transcription factors and signalling molecule ISH screen (Development. 2004 131:4047-58).

Original annotation :
Gene name :msxb.
Expression pattern : epidermis

Original annotation: LacZ MO was injected into the left and right posterior animal cells (b4.2) of eight-cell embryos. Msx expression was not affected in embryos injected with the LacZ MO. Embryo is shown with anterior to the left.

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord and various domains of the sensory vesicle, and around the palp forming region.”

Lateral view of a WT Ciona robusta mid tailbud embryo co-electroporated with Dmbx>GFP (green) and Msx>H2B:CFP (blue nuclei) reporter constructs.
GFP is observed in the motor ganglion. Asterisks indicate leaky Dmbx reporter expression in mesoderm.

Lateral view of a WT Ciona robusta mid tailbud embryo co-electroporated with Dmbx>GFP (green) and Msx>H2B:CFP (blue nuclei) reporter constructs.
Msx reporter construct is active in the central nervous system, in the muscles precursors at the tip of the tail and in the tail epidermis.

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord and various domains of the sensory vesicle, and around the palp forming region.”

Aniseed Comment : update of annotation of (Imai et al.,2004), based on (Imai et al.,2006).

“Msxb expression in the dorsal midline precursors was initiated very early, at the 64-cell stage. This expression occurred with no interruption during gastrulation and neurulation.”
“Msxb was expressed in the central nervous system (CNS), dorsal nerve cord and various domains of the sensory vesicle, and around the palp forming region.”

Lateral view of a WT Ciona robusta late tailbud embryo co-electroporated with Neurog b-line>unc76::GFP (green) and Msx>H2B::mCherry (magenta nuclei). Msx cis-regulatory region drives mCherry expression in the neural tube.
Scale bar 50 μm

Lateral view of a WT Ciona robusta late tailbud embryo co-electroporated with Neurog b-line>unc76::GFP (green) and Msx>H2B::mCherry (magenta nuclei). Neurog b-line cis-regulatory region drives GFP expression in the bipolar tail neurons precursors
Scale bar 50 μm

Dorsal view of a tadpole stage embryo electroporated with a lacZ transgene containing the -3,8kb to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the pharynx (ph), the sensory vesicle (sv), the neck (n) and the visceral ganglion (vg).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -3804bp/227bp

Tadpole stage embryo electroporated with a lacZ transgene containing the -2,5kb to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the pharynx, the sensory vesicle, the neck and the visceral ganglion. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -2545bp/227bp

Tadpole stage embryo electroporated with a lacZ transgene containing the -457bp to +238bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in the pharynx, the sensory vesicle, the neck and the visceral ganglion. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -469bp/227bp

Lateral view of a tadpole stage embryo electroporated with a LacZ transgene containing the -457 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence with an internal deletion between -205 bp to +130 bp. Expression is observed only in the pharynx (ph, pharynx).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -469bp/227bp delta -217bp/+118bp

Lateral view of a tadpole stage embryo electroporated with a LacZ transgene containing the -227 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is observed in in the sensory vesicle, in the neck and visceral ganglion but is lost in the pharynx (sv, sensory vesicle; n, neck; vg, visceral ganglion).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -239bp/227bp

Lateral view of a tadpole embryo electroporated with a LacZ transgene containing the -117 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is lost.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -129bp/227bp

Tadpole stage embryo electroporated with a LacZ transgene containing two N3 (atcgtcgcggccgaagcgtgaccaagtcgt) tandem repeats upstream the -117bp to the +238bp of the 5 flanking Ci-msxb enhancer sequence. Expression is observed in the sensory vesicle (sv), in the neck (n), in the visceral ganglion (vg) and in mesodermal cells. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -129bp/227bp

Tadpole stage embryo electroporated with a LacZ transgene containing two tandem repeats of the mutated N3 motif sequence (atcgtcgcggccgaagcgTGAccaagtcgt -> atcgtcgcggccgaagcgCAGccaagtcgt) in 5 of the -117bp to the +238bp of the 5 flanking Ci-msxb enhancer sequence. Expression is observed in mesodermal territories but expression in the nervous system is lost. No picture available in the paper.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -129bp/227bp

Tadpole embryo electroporated with a LacZ transgene containing the +130 bp to the +238 bp of the 5' flanking Ci-msxb enhancer sequence. Expression is lost.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : 119bp/227bp

Lateral view of a tadpole stage embryo electroporated with a LacZ transgene containing two N3 (atcgtcgcggccgaagcgtgaccaagtcgt) tandem repeats upstream the +130bp to the +238bp of the 5 flanking Ci-msxb enhancer sequence. Expression is observed in the sensory vesicle (sv), in the neck (n) and in the visceral ganglion (vg).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : 119bp/227bp

Lateral view of a tadpole stage embryo electroporated with a LacZ transgene containing two tandem repeats of the mutated N3 motif sequence atcgtcgcggccgaagcgTGAccaagtcgt -> atcgtcgcggccgaagcgCAGccaagtcgt in 5 of the +130bp to the +238bp of the 5 flanking Ci-msxb enhancer sequence. Expression is observed only in the head mesenchyme. Expression is lost in the sensory vesicle and in the neck/visceral ganglion.

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : 119bp/227bp

Lateral view of a tadpole stage embryo electroporated with a LacZ transgene containing the -227 bb to the +238 bp of the 5' flanking Ci-msxb enhancer sequence with an internal deletion between -84 bp to +130 bp. Expression is observed only in the neural territories (sv, sensory vesicle; n, neck; vg, visceral ganglion).

Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.
Coordinates in the paper : -239bp/227bp delta -96bp/+118bp