- Region 'REG00001582'
Cis-regulatory Region
Name
Cirobu.REG.KhL96:471236-471527_Tbox5-6-mut|Tbx2/3
Short name
Tbx2/3_294bp_T5T6m (José-Edwards 2013)
Region ID
REG00001582
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2023-02-23)
Annotator
Marion Gueroult-Bellone (2023-02-23)
Curator
Marion Gueroult-Bellone (2023-02-23)
Mutation of the 5th and 6th T-box binding sites neutralizes the notochord enhancer activity.
Modification of Cirobu.REG.KhL96:471236-471527|Tbx2/3 by substitution
- Cirobu.REG.KhL96:469627-471527|Tbx2/3 REG00001574 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527|Tbx2/3 REG00001575 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-6-7-mut|Tbx2/3 REG00001585 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-7-mut|Tbx2/3 REG00001584 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox6-7-mut|Tbx2/3 REG00001583 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-6-mut|Tbx2/3 REG00001582 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox7-mut|Tbx2/3 REG00001581 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox6-mut|Tbx2/3 REG00001580 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-mut|Tbx2/3 REG00001579 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471379-471527|Tbx2/3 REG00001577 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471407|Tbx2/3 REG00001576 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527|Tbx2/3 REG00001575 [ regulatory_region (enhancer) ]
CONS00001672: p.Cirobu.REG.KhL96:471236-471527_Tbox5-6-mut>LacZ
471,236471,527
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | T-Box | n/a | TGCCAC | [471,276 / 471,282] | 1st of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. |
2 | T-Box | n/a | TGACAC | [471,303 / 471,309] | 2nd of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. |
3 | T-Box | n/a | GTGGGA | [471,326 / 471,332] | 3rd of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. |
4 | T-Box | n/a | TGACAC | [471,361 / 471,367] | 4th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. |
5 | T-Box | n/a | TAACAC | [471,404 / 471,410] | 7th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. It's mutation alone does not affect the enhancer notochord activity and specificity. Mutated togeter with T-box5 and/or T-box6, it abrogates the notochord activity. |
6 | T-Box | n/a | TTTCAC | [471,447 / 471,453] | 8th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. |
7 | T-Box | n/a | TAGCAC | [471,476 / 471,482] | 9th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. |
Aniseed Coordinates: [471,236 / 471,527] on scaffold KhL96
The 5th and 6th T-box binding sites of the 294bp notochord enhancer of Tbx2/3 were mutated : GTG replaced by ata (in lowercase in the upper sequence). It is no longer active in notochord, only weakly in mesenchyme and tail muscles.
GTGGACAGACAGGGTAGTTAAATACGTTACAAAGTTCATTTGCCACCCAGCACAGTATTG
TACTTTATGACACTTGTGTTTATTCGTATAGTGGGACTAGTTATAAAATAAAACGGTTTA
TTCTCTGACACGTAAataTTAATCTATAAGCAATataACAAGAACAAATAACACGAAGGG
GCGAAATCTAACGCTAGATCAACTGCGTGGCTTTCACATCTTTGGTGGTCGAGTAATACA
TAGCACTAAACCGAAACAATTATTTTTCGTCGACTACCGTAATCCCCATTCC