Description

This 125bp fragment is located in the 3rd intron of Rx (KH.C12.152), and its sequence is highly conservated with Ciona savigny. Cloned upstream a basal promoter and LacZ reporter gene, it has no activity.

Hierarchy of Regulatory Regions

Regulated gene(s)

KH2012:KH.C12.152 (PAX6; RAX; RAX2)

Construct(s) made to test this region

CONS00001603: p.Cirobu.REG.KH2012.C12:1337780-1337904>LacZ

Overview of functional TF binding sites in this region

1,337,7801,337,904

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [1,337,780 / 1,337,904] on scaffold KhC12

Primers used to amplify this sequence : INTR 0.12 up :AAAATAACTGGAAACACTGTTAC and INTR 0.12 down : GCAATAACATATCAAATTGGCTG

Reference(s)

D'Aniello et al. (2011). Onecut is a direct neural-specific transcriptional activator of Rx in Ciona intestinalis. Dev. Biol. 355(2):358-71