Description

This small fragment is sufficient to recapitulate Vsx expression.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KhC11:4100254-4102604|Vsx by deletion

Regulated gene(s)

KH2012:KH.C11.689 (ALX4; VSX1; VSX2)

Construct(s) made to test this region

CONS00001626: p.Cirobu.REG.KhC11:4100672-4100951>GFP

CONS00001595: p.Cirobu.REG.KhC11:4100672-4100951>unc76::GFP

CONS00001631: p.Cirobu.REG.KhC11:4100672-4100951>unc76::mCherry

Overview of functional TF binding sites in this region

4,100,6724,100,951

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [4,100,672 / 4,100,951] on scaffold KhC11

A smaller 279 bp fragment within the 3rd intron of Vsx was found to be sufficient to recapitulate Vsx expression. This smaller piece was amplified using Vsx intron3 F (GTTTGTCATTTTCGTTCCTTGG) and Vsx intron 3 R (AGAAGAAGTACAGGTCTCACC).

Reference(s)

Stolfi et al. (2011). Neuronal subtype specification in the spinal cord of a protovertebrate. Development 138(5):995-1004

Stolfi et al. (2011). Neural tube patterning by Ephrin, FGF and Notch signaling relays. Development 138(24):5429-39