Description

This 264bp sequence is Dmbx minimal enhancer and is located upstream of Dmbx gene model. It is active in the A12.239 neuron pair at larval stages.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KhC1.9789507-9792995|Dmbx by deletion

Regulated gene(s)

KH2012:KH.C1.1212 (DMBX1; DRGX; PITX3)

Construct(s) made to test this region

CONS00001560: p.Cirobu.REG.KhC1:9790575-9790838>GFP

CONS00001629: p.Cirobu.REG.KhC1:9790575-9790838>mCherry

Overview of functional TF binding sites in this region

9,790,5759,790,838

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment
1	Paired	KH2012:KH.C10.150	gcgcgaaat	[9,790,679 / 9,790,688]	Mutation of the predicted Pax3/7 site abolishes the activity of Dmbx minimal enhancer.

Sequence

Aniseed Coordinates: [9,790,575 / 9,790,838] on scaffold KhC1

Dmbx minimal enhancer from C. intestinalis was PCR-amplified with the following primers: Dmbx min F: TTTGTGACGTCACGCCTTAAC; Dmbx min R: AGTACTATGACGTTACAATCC. This sequence is active in the A12.239 neuron pair at larval stages.

Reference(s)

Stolfi et al. (2011). Neural tube patterning by Ephrin, FGF and Notch signaling relays. Development 138(24):5429-39