Description

This 173bp sequence, located upstream of SOCS7 (S23.g02476 ), drives reporter gene expression.

Hierarchy of Regulatory Regions

Regulated gene(s)

Phmamm.CG.MTP2014.S70.g02476 (SOCS6; SOCS7)

Construct(s) made to test this region

CONS00001472: p.Phmamm.REG.CG.MTP2014.S70:155422-155594>LacZ

Overview of functional TF binding sites in this region

155,422155,594

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [155,422 / 155,594] on scaffold S70

This sequence was retrieved using ANISEED Blast tool. Primer used for cloning : Forward : attgaacgctgtcacataacc Reverse : ggacaagcagtaaacaacagca

Reference(s)

Madgwick et al. (2019). Evolution of embryonic cis-regulatory landscapes between divergent Phallusia and Ciona ascidians. Dev. Biol. 448(2):71-87