Description

This 259bp sequence, located upstream of Lefty (S362.g07801), drives reporter gene expression in endoderm, TLCS, mesenchyme, notochord, brain, muscle, nerve cord and epidermis territories.

Hierarchy of Regulatory Regions

Regulated gene(s)

Phmamm.CG.MTP2014.S362.g07801 (BMP10; LEFTY1; LEFTY2)

Construct(s) made to test this region

CONS00001471: p.Phmamm.REG.CG.MTP2014.S362:37650-37908>LacZ

Overview of functional TF binding sites in this region

37,65037,908

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [37,650 / 37,908] on scaffold S362

This sequence was retrieved using ANISEED Blast tool. Primer used for cloning : Forward : cttttgcaaccgtgcgttc Reverse : caacaacttttacctccttacgttt

Reference(s)

Madgwick et al. (2019). Evolution of embryonic cis-regulatory landscapes between divergent Phallusia and Ciona ascidians. Dev. Biol. 448(2):71-87