Description

This 253bp sequence, located in the second intron of Eph1 (S160.g04451), drives reporter gene expression in endoderm and mesenchyme.

Hierarchy of Regulatory Regions

Regulated gene(s)

Phmamm.CG.MTP2014.S160.g04451 (EPHA4; EPHA7; EPHB1)

Construct(s) made to test this region

CONS00001463: p.Phmamm.REG.CG.MTP2014.S160:17627-17879>LacZ

Overview of functional TF binding sites in this region

17,62717,879

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [17,627 / 17,879] on scaffold S160

This sequence was retrieved using ANISEED Blast tool. Primer used for cloning : Forward : tatgcttgacacccacggta Reverse : tttgtcgtcgcaattgaaaa

Reference(s)

Madgwick et al. (2019). Evolution of embryonic cis-regulatory landscapes between divergent Phallusia and Ciona ascidians. Dev. Biol. 448(2):71-87