Description

This 210bp sequence, located in the first intron of Nodal (S1711.g15500), drives reporter gene expression in mesenchyme and sensory vesicle.

Hierarchy of Regulatory Regions

Regulated gene(s)

Phmamm.CG.MTP2014.S1711.g15500 (BMP10; GDF6; NODAL)

Construct(s) made to test this region

CONS00001449: p.Phmamm.REG.CG.MTP2014.S1711:7214-7423>LacZ

Overview of functional TF binding sites in this region

7,2147,423

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [7,214 / 7,423] on scaffold S1711

This sequence was retrieved using ANISEED Blast tool. Primer used for cloning : Forward : acaaaatcaaccgcgttgtc Reverse : acgctttattcgagggtggt

Reference(s)

Madgwick et al. (2019). Evolution of embryonic cis-regulatory landscapes between divergent Phallusia and Ciona ascidians. Dev. Biol. 448(2):71-87