Description

This 366bp sequence, located in an intronic region of Otx (KH.C4.84), drives strong reliable reporter gene expression in endoderm,mesenchyme, muscle and weak expression in epidermis territories.

Hierarchy of Regulatory Regions

Regulated gene(s)

KH2012:KH.C4.84 (CRX; OTX1; OTX2)

Construct(s) made to test this region

CONS00001431: p.Cirobu.REG.KH2012.C4:4314434-4314799>LacZ

Overview of functional TF binding sites in this region

4,314,4344,314,799

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [4,314,434 / 4,314,799] on scaffold KhC4

This sequence was retrieved using ANISEED Blast tool. Primer used for cloning : Forward : GAGATCCCGCCTTGTGACTA Reverse : AACAATTCTTAGCGGGTGGT

Reference(s)

Madgwick et al. (2019). Evolution of embryonic cis-regulatory landscapes between divergent Phallusia and Ciona ascidians. Dev. Biol. 448(2):71-87