- Transcript 'Haaura.CG.MTP2014.S1...' >
- Transcript 'Moocci.CG.ELv1_2.S23...' >
- Molecular Tool 'citb15m10-MO' >
- Region 'REG00001396'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.S605:17540-17833|βγ-crystallin
Short name
n/a
Region ID
REG00001396
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(extended_promoter)
Author
n/a ()
Annotator
Marion Gueroult-Bellone (2018-05-25)
Curator
Marion Gueroult-Bellone (2018-05-25)
This 294bp sequence, located in the intergenic region upstream of βγ-crystallin (S605.3), drives reporter gene expression in palps. It contains 184bp upstream of the TSS and 110bp downstream. It contains 1 Cdx, 1 Fox, 1 CREB and 1 Nkx/POU putative binding sites conserved with Ciona savigny. Compared to the -275bp/+110bp enhancer, it lacks 1 Sox and 1 Cdx conserved binding sites and is not able to drive gene expression in pigment cells.
Modification of Cirobu.REG.KH2012.S605:17448-17833|βγ-crystallin by deletion
- Cirobu.REG.KH2012.S605:16609-17833|βγ-crystallin REG00001389 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:16789-17833|βγ-crystallin REG00001202 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:16809-17833|βγ-crystallin REG00001390 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17009-17833|βγ-crystallin REG00001391 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17209-17833|βγ-crystallin REG00001392 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17409-17833|βγ-crystallin REG00001393 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833|βγ-crystallin REG00001394 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17471-17833|βγ-crystallin REG00001395 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17540-17833|βγ-crystallin REG00001396 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_SoxMut|βγ-crystallin REG00001399 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_Cdx1Mut|βγ-crystallin REG00001400 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_FoxMut|βγ-crystallin REG00001402 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_CREBmut|βγ-crystallin REG00001403 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833|βγ-crystallin REG00001394 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17409-17833|βγ-crystallin REG00001393 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17209-17833|βγ-crystallin REG00001392 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17009-17833|βγ-crystallin REG00001391 [ regulatory_region (extended_promoter) ]
17,54017,833
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Homeobox | n/a | aattat | [17,541 / 17,547] | This is the 2nd of the 2 Cdx binding sites located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of both Cdx binding sites inhibits enhancer activity in pigment cells and palps. So does the deletion of the region containing this binding site and its upstream neighbours. |
2 | Fox | n/a | tgtttgt | [17,555 / 17,562] | This Fox binding site is located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of this Fox binding site inhibits enhancer activity in pigment cells and reduces enhancer activity in palps. |
3 | bZIP | n/a | gtcataa | [17,617 / 17,624] | This CREB binding site is located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of this CREB binding site inhibits enhancer activity in pigment cells. |
4 | Homeobox | n/a | tgtta | [17,624 / 17,629] | This Nkx/POU binding site is located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. |
Aniseed Coordinates: [17,540 / 17,833] on scaffold KhS605
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in Fig2B of Chen et al. 2014.
taattatcgtgacgttgtttgttttaaaaacccatttattattacgtcataatactttag
atggttgtgtatgttacgtcataatgttaattgttgaataaaaatgaagaaacaaagcca
tgaagaaggcggtttgttataaaacattgttgaagggatggaattaattatgttgttaac
gtttgaattattgatgtaacaaggacgacaagtgagcgcaaatcagatttcgtttacttt
ccttctaaccctcctaaccactgcttatttcgcattttgtacaatcgaagtttc