- Region 'REG00001350' >
- Region 'REG00001375'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut3|Furin,Nec1/2
Short name
n/a
Region ID
REG00001375
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-16)
Annotator
Marion Gueroult-Bellone (2018-05-16)
Curator
Marion Gueroult-Bellone (2018-05-16)
This 547bp sequence, located in an intronic region of KH.L128.2, drives reporter gene expression in tail muscles, mesenchyme and central nervous system, but not in the notochord as the WT enhancer does. It contains 1 Myb#2, 7 Brachyury, 2 Fox, 3 E-box, 1 Myb#3 and 1 Sp1/Klf putative binding sites.
Modification of Cirobu.REG.KH2012.L128:214487-215033|Furin,Nec1/2 by substitution
- Cirobu.REG.KH2012.L128:214285-215843|Furin,Nec1/2 REG00001365 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.L128:215034-215843|Furin,Nec1/2 REG00001366 [ no_output ]
- Cirobu.REG.KH2012.L128:214285-215033|Furin,Nec1/2 REG00001367 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214285-215033_Fox3Mut|Furin,Nec1/2 REG00001368 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214285-215033_Bra8Mut|Furin,Nec1/2 REG00001369 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214285-215033_Bra4Mut|Furin,Nec1/2 REG00001370 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214487-215033|Furin,Nec1/2 REG00001371 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214719-215033|Furin,Nec1/2 REG00001372 [ no_output ]
- Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut1|Furin,Nec1/2 REG00001373 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut2|Furin,Nec1/2 REG00001374 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut3|Furin,Nec1/2 REG00001375 [ regulatory_region (enhancer) ]
CONS00001395: p.Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut3>LacZ
214,487215,033
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Helix Turn Helix / Tryptophane clusters | n/a | ccgttgg | [214,502 / 214,509] | This Myb#3 binding site is located on the notochord-active intronic enhancer of KH.L128.2. |
2 | T-Box | n/a | tagcac | [214,578 / 214,584] | This is the second of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
3 | bHLH | n/a | cacatg | [214,581 / 214,587] | This is the second of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
4 | bHLH | n/a | catttg | [214,593 / 214,599] | This is the third of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
5 | ZnF_(C2H2) | n/a | ccacc | [214,616 / 214,621] | This Sp1/Klf binding site is located on the notochord-active intronic enhancer of KH.L128.2. |
6 | T-Box | n/a | tttcac | [214,633 / 214,639] | This is the third of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
7 | bHLH | n/a | cagatg | [214,647 / 214,653] | This is the fourth of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
8 | T-Box | n/a | tgacac | [214,680 / 214,686] | This is the fourth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation or the mutation of the adjacent bases inhibits the enhancer activity in the notochord. |
9 | T-Box | n/a | ttacac | [214,697 / 214,703] | This is the fifth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
10 | Fox | n/a | tatttgc | [214,735 / 214,742] | This is the second of the 2 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
11 | T-Box | n/a | gtggaa | [214,782 / 214,788] | This is the 6th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
12 | T-Box | n/a | gtgaaa | [214,801 / 214,807] | This is the 7th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
13 | Fox | n/a | ataaaca | [214,864 / 214,871] | This is the third of the 3 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation does not affect enhancer activity in the notochord, but it increases activity in the mesenchyme. |
14 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [214,917 / 214,923] | This is the second of the 2 Myb#2 binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
15 | T-Box | n/a | gtgcca | [214,965 / 214,971] | This is the 8th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation decreases but does not inhibit enhancer activity in the notochord. |
Aniseed Coordinates: [214,487 / 215,033] on scaffold KhL128
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.c and TableS5 of Jose-Edwards et al. 2015. The sequence located directly next to the 4th Brachyrury binding site is mutated. ctaaGTGTCA replaced by agccGTGTCA.
ggctcgaacccacgaccgttggattaagagtccaacgctctaccgactgagctagcaggg
cggtagagatgaactgattaaggtatcctgttagcacatgcaacttcatttgtgattata
gcattagaaccaccgccgcaacagtgtttcacaacagaagcagatgaagcattttgtttt
ttcttgtcaacactgacacGTTAttgttgattacactcgcgcgtactttgcaagcttttt
tggtaagctatttgcttgtgaagctgtagcaatgtagcaggacaaactactaaatgtgga
aagtataaaacttagtgaaacgagtattttgtatatattaatctggcatttaaaaatcag
cgtttatgttagtttgtataaacagaactggctcgaattcaacatcaaagctattattgt
tattggtattattgaaggggatgaaaaaaacgccagtgtttggtggatatactgatgtgt
gccatgtacgctgccgtattttatatgtattcgttactttatacaatgtgttttgatgta
tgcatgt