- Clone 'cicl041n04' >
- Clone 'AHC0AAA29YN05' >
- Region 'REG00001366' >
- Region 'REG00001371'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.L128:214487-215033|Furin,Nec1/2
Short name
n/a
Region ID
REG00001371
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-16)
Annotator
Marion Gueroult-Bellone (2018-05-16)
Curator
Marion Gueroult-Bellone (2018-05-16)
This 547bp sequence, located in an intronic region of KH.L128.2, drives reporter gene expression in notochord central nervous system. It contains 1 Myb#2, 7 Brachyury, 2 Fox, 3 E-box, 1 Myb#3 and 1 Sp1/Klf putative binding sites.
Modification of Cirobu.REG.KH2012.L128:214285-215033|Furin,Nec1/2 by deletion
- Cirobu.REG.KH2012.L128:214285-215843|Furin,Nec1/2 REG00001365 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.L128:215034-215843|Furin,Nec1/2 REG00001366 [ no_output ]
- Cirobu.REG.KH2012.L128:214285-215033|Furin,Nec1/2 REG00001367 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214285-215033_Fox3Mut|Furin,Nec1/2 REG00001368 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214285-215033_Bra8Mut|Furin,Nec1/2 REG00001369 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214285-215033_Bra4Mut|Furin,Nec1/2 REG00001370 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214487-215033|Furin,Nec1/2 REG00001371 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214719-215033|Furin,Nec1/2 REG00001372 [ no_output ]
- Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut1|Furin,Nec1/2 REG00001373 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut2|Furin,Nec1/2 REG00001374 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut3|Furin,Nec1/2 REG00001375 [ regulatory_region (enhancer) ]
214,487215,033
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Helix Turn Helix / Tryptophane clusters | n/a | ccgttg | [214,502 / 214,508] | This Myb#3 binding site is located on the notochord-active intronic enhancer of KH.L128.2. |
2 | T-Box | n/a | tagcac | [214,578 / 214,584] | This is the second of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
3 | bHLH | n/a | cacatg | [214,581 / 214,587] | This is the second of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
4 | bHLH | n/a | catttg | [214,593 / 214,599] | This is the third of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
5 | ZnF_(C2H2) | n/a | ccacc | [214,616 / 214,621] | This Sp1/Klf binding site is located on the notochord-active intronic enhancer of KH.L128.2. |
6 | T-Box | n/a | tttcac | [214,633 / 214,639] | This is the third of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
7 | bHLH | n/a | cagatg | [214,647 / 214,653] | This is the fourth of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
8 | T-Box | n/a | tgacac | [214,680 / 214,686] | This is the fourth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation or the mutation of the adjacent bases inhibits the enhancer activity in the notochord. |
9 | T-Box | n/a | ttacac | [214,697 / 214,703] | This is the fifth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
10 | Fox | n/a | tatttgc | [214,735 / 214,742] | This is the second of the 2 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
11 | T-Box | n/a | gtggaa | [214,782 / 214,788] | This is the 6th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
12 | T-Box | n/a | gtgaaa | [214,801 / 214,807] | This is the 7th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
13 | Fox | n/a | ataaaca | [214,864 / 214,871] | This is the third of the 3 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation does not affect enhancer activity in the notochord, but it increases activity in the mesenchyme. |
14 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [214,917 / 214,923] | This is the second of the 2 Myb#2 binding sites located on the notochord-active intronic enhancer of KH.L128.2. |
15 | T-Box | n/a | gtgcca | [214,965 / 214,971] | This is the 8th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation decreases but does not inhibit enhancer activity in the notochord. |
Aniseed Coordinates: [214,487 / 215,033] on scaffold KhL128
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.c and TableS5 of Jose-Edwards et al. 2015.
ggctcgaacccacgaccgttggattaagagtccaacgctctaccgactgagctagcaggg
cggtagagatgaactgattaaggtatcctgttagcacatgcaacttcatttgtgattata
gcattagaaccaccgccgcaacagtgtttcacaacagaagcagatgaagcattttgtttt
ttcttgtcaacactgacacttagttgttgattacactcgcgcgtactttgcaagcttttt
tggtaagctatttgcttgtgaagctgtagcaatgtagcaggacaaactactaaatgtgga
aagtataaaacttagtgaaacgagtattttgtatatattaatctggcatttaaaaatcag
cgtttatgttagtttgtataaacagaactggctcgaattcaacatcaaagctattattgt
tattggtattattgaaggggatgaaaaaaacgccagtgtttggtggatatactgatgtgt
gccatgtacgctgccgtattttatatgtattcgttactttatacaatgtgttttgatgta
tgcatgt