- Region 'REG00001362'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C1:9941324-9941439_9941369-9941487|C6ST-like7
Short name
n/a
Region ID
REG00001362
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-09)
Annotator
Marion Gueroult-Bellone (2018-05-09)
Curator
Marion Gueroult-Bellone (2018-05-09)
This 134bp sequence, located in the downstream region of KH.C1.738, drives reporter gene expression in notochord. It contains 2 Fox, 2 Brachyury and 2 Myb#1 putative binding sites. Compared to the WT enhancer, it lacks one Fox and one Myb#1 binding sites.
Modification of Cirobu.REG.KH2012.C1:9941324-9941487|C6ST-like7 by deletion
- Cirobu.REG.KH2012.C1:9941324-9941700|C6ST-like7 REG00001359 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.C1:9941324-9941487|C6ST-like7 REG00001360 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C1:9941324-9941487_Myb1-2Mut|C6ST-like7 REG00001361 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C1:9941324-9941439_9941369-9941487|C6ST-like7 REG00001362 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C1:9941405-9941487|C6ST-like7 REG00001363 [ no_output ]
- Cirobu.REG.KH2012.C1:9941324-9941404|C6ST-like7 REG00001364 [ no_output ]
- Cirobu.REG.KH2012.C1:9941324-9941487|C6ST-like7 REG00001360 [ regulatory_region (enhancer) ]
CONS00001382: p.Cirobu.REG.KH2012.C1:9941324-9941439_9941369-9941487>LacZ
9,941,3249,941,487
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | T-Box | n/a | ttccac | [9,941,332 / 9,941,338] | This is one of the 2 Brachyury binding sites located in the notochord-active enhancer of KH.C1.738 (C6ST-like7). |
2 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [9,941,352 / 9,941,356] | This is one of the 3 Myb#1 binding sites located in the notochord-active enhancer of KH.C1.738 (C6ST-like7). |
3 | T-Box | n/a | gtgata | [9,941,357 / 9,941,363] | This is one of the 2 Brachyrury binding sites located in the notochord-active enhancer of KH.C1.738 (C6ST-like7). |
4 | Fox | n/a | tgtttac | [9,941,384 / 9,941,391] | This is one of the 3 Fox binding sites located in the notochord-active enhancer of KH.C1.738 (C6ST-like7). |
5 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [9,941,402 / 9,941,406] | This is one of the 3 Myb#1 binding sites located in the notochord-active enhancer of KH.C1.738 (C6ST-like7). Mutation of this second Myb#1 BS inhibits enhancer activity in the notochord and creates new enhancer activity in the mesenchyme |
6 | Fox | n/a | tatttac | [9,941,433 / 9,941,440] | This is one of the 3 Fox binding sites located in the notochord-active enhancer of KH.C1.738 (C6ST-like7). |
Aniseed Coordinates: [9,941,324 / 9,941,487] on scaffold KhC1
30bp containing the first Fox and Myb#1 binding sites are deleted (dashes). This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1.f and TableS5 of Jose-Edwards et al. 2015.
ccctcgcattccacattctcgttttcattaacagtgataatgcctatctcgaaaactcta
tgtttactcttaggaatgtaacaagtatctgcgagaagtaatcagacggtatttac----
--------------------------atctaggattctctagag