- Region 'REG00001349' >
- Region 'REG00001328' >
- Region 'REG00001348'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C5:4471987-4472163|Rfx1/2/3
Short name
n/a
Region ID
REG00001348
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-08)
Annotator
Marion Gueroult-Bellone (2018-05-08)
Curator
Marion Gueroult-Bellone (2018-05-08)
This 178bp sequence, located in the downstream region of KH.C5.399, drives reporter gene expression in notochord. It contains 2 Myb#1, 1 E-box, 1 Fox, 3 Myb#2, 1 Brachyury and 1 Myb#3 putative binding sites.
Modification of Cirobu.REG.KH2012.C5:4471851-4472163|Rfx1/2/3 by deletion
- Cirobu.REG.KH2012.C5:4471567-4472163|Rfx1/2/3 REG00001341 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 REG00001342 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut|Rfx1/2/3 REG00001343 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2Mut|Rfx1/2/3 REG00001344 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut_Myb2-2Mut|Rfx1/2/3 REG00001345 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471851-4472163|Rfx1/2/3 REG00001346 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2orientationReversed|Rfx1/2/3 REG00001385 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5/Myb2-2exchange|Rfx1/2/3 REG00001386 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_insertion|Rfx1/2/3 REG00001387 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 REG00001342 [ regulatory_region (enhancer) ]
4,471,9874,472,163
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [4,472,025 / 4,472,031] | This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site does not affect the enhancer activity in the notochord. |
2 | T-Box | n/a | gtgtta | [4,472,035 / 4,472,041] | This Brachyury binding site is located in the notochord-active enhancer of KH.C5.399. Mutation of this Brachyury binding site does not affect the enhancer activity in the notochord. |
3 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,472,039 / 4,472,043] | This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site does not affect the enhancer activity in the notochord. |
4 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,472,039 / 4,472,043] | This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site does not affect the enhancer activity in the notochord. |
5 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,472,044 / 4,472,048] | This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#2 binding site inhibits enhancer activity in the notochord. |
6 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [4,472,052 / 4,472,058] | This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#1 binding site inhibits enhancer activity in the notochord. |
7 | bHLH | n/a | caaatg | [4,472,076 / 4,472,082] | This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399. |
8 | Fox | n/a | tgtttgt | [4,472,101 / 4,472,108] | This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399. |
9 | Helix Turn Helix / Tryptophane clusters | n/a | ttcaat | [4,472,129 / 4,472,135] | This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. |
10 | Helix Turn Helix / Tryptophane clusters | n/a | ccgttg | [4,472,145 / 4,472,151] | This Myb#3 binding site is located in the notochord-active enhancer of KH.C5.399. Its mutation does not affect the enhancer activity in the notochord. |
Aniseed Coordinates: [4,471,987 / 4,472,163] on scaffold KhC5
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1.d and TableS5 of Jose-Edwards et al. 2015.
ccagtaatgagtttcgtacagaatacgttgcgccgtgaattgaaatgtgtgttaacttaa
cctagattgaatgcattccgtctcgagtacaaatgcctttctgatttgttgtcttgtttg
ttttgcgtctctctcgctcttgttcaatatttagaaagccgttgtgactatgctgtg