Login
Help

CIS-REGULATION

Submit your Data

  1. Transcript 'Cisavi.CG.ENS81.R15....' > 
  2. Transcript 'Boleac.CG.SB_v3.S188...' > 
  3. Region 'REG00000482' > 
  4. Region 'REG00000068' > 
  5. Region 'REG00001345'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut_Myb2-2Mut|Rfx1/2/3

Short name

n/a

Region ID

REG00001345

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-05-08)

Annotator

Marion Gueroult-Bellone (2018-05-08)

Curator

Marion Gueroult-Bellone (2018-05-08)

View position in WashU

Description

This 89bp sequence, located in the downstream region of KH.C5.399, drives reporter gene expression in mesenchyme, head epidermis and central nervous system, but not in notochord. It contains 4 Myb#1, 2 E-box, 2 Fox, 2 Myb#2, 1 Brachyury and 1 Myb#3 putative binding sites. Compared to the notochord-active WT enhancer, it lacks the second Myb#2 and the 5th Myb#1 binding sites.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 by deletion

Regulated gene(s)

KH2012:KH.C5.399 (RFX1; RFX2; RFX3)

Construct(s) made to test this region

CONS00001365: p.Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut_Myb2-2Mut>LacZ

Show in situ data
Overview of functional TF binding sites in this region

4,471,7384,472,163

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,870 / 4,471,874] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
2 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,875 / 4,471,879] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
3 Helix Turn Helix / Tryptophane clusters n/a taac [4,471,912 / 4,471,916] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
4 bHLH n/a catttg [4,471,920 / 4,471,926] This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399.
5 Fox n/a tgtttac [4,471,981 / 4,471,988] This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399.
6 Helix Turn Helix / Tryptophane clusters n/a attgaa [4,472,025 / 4,472,031] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site does not affect the enhancer activity in the notochord.
7 T-Box n/a gtgtta [4,472,035 / 4,472,041] This Brachyury binding site is located in the notochord-active enhancer of KH.C5.399. Mutation of this Brachyury binding site does not affect the enhancer activity in the notochord.
8 Helix Turn Helix / Tryptophane clusters n/a taac [4,472,039 / 4,472,043] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site does not affect the enhancer activity in the notochord.
9 bHLH n/a caaatg [4,472,076 / 4,472,082] This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399.
10 Fox n/a tgtttgt [4,472,101 / 4,472,108] This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399.
11 Helix Turn Helix / Tryptophane clusters n/a ttcaat [4,472,129 / 4,472,135] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399.
12 Helix Turn Helix / Tryptophane clusters n/a ccgttg [4,472,145 / 4,472,151] This Myb#3 binding site is located in the notochord-active enhancer of KH.C5.399. Its mutation does not affect the enhancer activity in the notochord.

Sequence

Aniseed Coordinates: [4,471,738 / 4,472,163] on scaffold KhC5

The 5th Myb#1 and the second Myb#2 binding sites are mutated. TAAC replaced by TGGT and ATTGAA replaced by ACCAAA respectively. This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1.d and TableS5 of Jose-Edwards et al. 2015.

Show sequence

Length: 426


tgccaggtatgtctaaattcaacagcttcggtaatggcgcattctttgtcataattatac
ggaggcaggctggtgtacgaagaaattccatttcgacacgacatgttgcgctgtagtgac
tcaagtttcaaagttatgttaagctttaagaaaagtgtagacaggcgtactgcttaacaa
aacatttgcagactattaaaaattatttaaagtattaataagcgctactttaatattttt
gtatgtttaccagtaatgagtttcgtacagaatacgttgcgccgtgaattgaaatgtgtg
ttaacttGGTctagaCCAaatgcattccgtctcgagtacaaatgcctttctgatttgttg
tcttgtttgttttgcgtctctctcgctcttgttcaatatttagaaagccgttgtgactat
gctgtg

Reference(s)

José-Edwards et al. (2015). Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord. PLoS Genet. 11(12):e1005730

Back to Top