- Clone 'cima003c16' >
- Region 'REG00000073' >
- Transcript 'Moocul.CG.ELv1_2.S85...' >
- Clone 'cien222507' >
- Region 'REG00001323'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C9:35651-35739_Bra2mut|Fkbp9
Short name
n/a
Region ID
REG00001323
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-08)
Annotator
Marion Gueroult-Bellone (2018-05-08)
Curator
Marion Gueroult-Bellone (2018-05-08)
This 89bp sequence, located in the upstream region of KH.C9.778, drives reporter gene expression in mesenchyme and tail muscles, but not in notochord. It contains 1 Sp1/Klf, 3 E-box and 2 Brachyury putative binding sites. Compared to the active WT enhancer, it lacks the second Brachyury binding site.
Modification of Cirobu.REG.KH2012.C9:35651-35739|Fkbp9 by substitution
- Cirobu.REG.KH2012.C9:35562-36707|Fkbp9 REG00001318 [ regulatory_region (complex_region) ]
CONS00001343: p.Cirobu.REG.KH2012.C9:35651-35739_Bra2mut>LacZ
35,65135,739
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | T-Box | n/a | gtgcaa | [35,668 / 35,674] | This is the third of the 3 Brachyury binding sites located in the notochord enhancer of KH.C9.778. Its mutation does not affect enhancer activity in the notochord. Deletion of the region containing 2nd and 3rd Brachyury binding sites inhibits enhancer activity in the notochord. |
2 | T-Box | n/a | taacac | [35,688 / 35,694] | This is one of the 3 Brachyury binding sites located in the notochord enhancer of KH.C9.778. |
3 | bHLH | n/a | cacgtg | [35,691 / 35,697] | This is one of the 3 E-box binding sites located in the notochord enhancer of KH.C9.778. |
4 | bHLH | n/a | catttg | [35,704 / 35,710] | This is one of the 3 E-box binding sites located in the notochord enhancer of KH.C9.778. |
5 | bHLH | n/a | caattg | [35,725 / 35,731] | This is one of the 3 E-box binding sites located in the notochord enhancer of KH.C9.778. Its mutation does not affect ehnacer activity. |
6 | ZnF_(C2H2) | n/a | ggtgg | [35,730 / 35,735] | This Sp1/Klf binding site is located in the notochord enhancer of KH.C9.778. |
Aniseed Coordinates: [35,651 / 35,739] on scaffold KhC9
The second Brachyury binding site is mutated. TTTCAC replaced by TTTTCT. This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1ab and TableS5 of Jose-Edwards et al. 2015.
cagcatgtctagcttttgtgcaataaggcAGAaaaagtaacacgtgacttcaacatttgc
tcaatgctggaaagcaattggtggataag