- Region 'REG00001321'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C9:35651-35739|Fkbp9
Short name
n/a
Region ID
REG00001321
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-08)
Annotator
Marion Gueroult-Bellone (2018-05-08)
Curator
Marion Gueroult-Bellone (2018-05-08)
This 89bp sequence, located in the upstream region of KH.C9.778, drives reporter gene expression in notochord, tail muscle, mesenchyme and central nervous system. It contains 1 Sp1/Klf, 3 E-box and 3 Brachyury putative binding sites.
Modification of Cirobu.REG.KH2012.C9:35651-35811|Fkbp9 by deletion
- Cirobu.REG.KH2012.C9:35562-36707|Fkbp9 REG00001318 [ regulatory_region (complex_region) ]
35,65135,739
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | T-Box | n/a | gtgcaa | [35,668 / 35,674] | This is the third of the 3 Brachyury binding sites located in the notochord enhancer of KH.C9.778. Its mutation does not affect enhancer activity in the notochord. Deletion of the region containing 2nd and 3rd Brachyury binding sites inhibits enhancer activity in the notochord. |
2 | T-Box | n/a | gtgaaa | [35,680 / 35,686] | This is the second of the 3 Brachyury binding sites located in the notochord enhancer of KH.C9.778. Its mutation or deletion inhibits enhancer activity in the notochord. |
3 | T-Box | n/a | taacac | [35,688 / 35,694] | This is one of the 3 Brachyury binding sites located in the notochord enhancer of KH.C9.778. |
4 | bHLH | n/a | cacgtg | [35,691 / 35,697] | This is one of the 3 E-box binding sites located in the notochord enhancer of KH.C9.778. |
5 | bHLH | n/a | catttg | [35,704 / 35,710] | This is one of the 3 E-box binding sites located in the notochord enhancer of KH.C9.778. |
6 | bHLH | n/a | caattg | [35,725 / 35,731] | This is one of the 3 E-box binding sites located in the notochord enhancer of KH.C9.778. Its mutation does not affect ehnacer activity. |
7 | ZnF_(C2H2) | n/a | ggtgg | [35,730 / 35,735] | This Sp1/Klf binding site is located in the notochord enhancer of KH.C9.778. |
Aniseed Coordinates: [35,651 / 35,739] on scaffold KhC9
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1ab and TableS5 of Jose-Edwards et al. 2015.
cagcatgtctagcttttgtgcaataaggcgtgaaaagtaacacgtgacttcaacatttgc
tcaatgctggaaagcaattggtggataag