- Region 'REG00001333' >
- Region 'REG00001261' >
- Region 'REG00001334' >
- Transcript 'Phmamm.CG.MTP2014.S3...' >
- Region 'REG00001309'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.L65:311070-311303_BraMut1|Dyrk2/3/4
Short name
n/a
Region ID
REG00001309
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-08)
Annotator
Marion Gueroult-Bellone (2018-05-08)
Curator
Marion Gueroult-Bellone (2018-05-08)
This 228bp sequence, located in the upstream region of KH.L65.10, drives reporter gene expression in notochord and mesenchyme. It contains 2 Fox, 2 E-box and 2 Brachyury putative binding sites (One Bra BS is mutated). Compared to the active WT 228bp enhancer, its pattern of expression is not limited to notochord.
Modification of Cirobu.REG.KH2012.L65:311070-311303|Dyrk2/3/4 by substitution
- Cirobu.REG.KH2012.L65:310840-311303|Dyrk2/3/4 REG00001306 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.L65:310840-311092|Dyrk2/3/4 REG00001307 [ no_output ]
- Cirobu.REG.KH2012.L65:311070-311303|Dyrk2/3/4 REG00001308 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L65:311070-311303_BraMut1|Dyrk2/3/4 REG00001309 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L65:311070-311303_BraMut2|Dyrk2/3/4 REG00001310 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L65:311070-311303_BraMut3|Dyrk2/3/4 REG00001311 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L65:311070-311303_Fox1Mut|Dyrk2/3/4 REG00001312 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.L65:311070-311303_Fox2Mut|Dyrk2/3/4 REG00001313 [ regulatory_region (enhancer) ]
CONS00001329: p.Cirobu.REG.KH2012.L65:311070-311303_BraMut1>LacZ
311,070311,303
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | T-Box | n/a | gtgtaa | [311,169 / 311,175] | This is one of the 6 Brachyrury binding sites located in the notochord-active enhancer of KH.L65.10. |
2 | Fox | n/a | gtaaata | [311,171 / 311,178] | This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.L65.10. Its mutation does not affect the enhancer activity in the notochord. |
3 | bHLH | n/a | catctg | [311,181 / 311,187] | This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.L65.10. |
4 | bHLH | n/a | cacatg | [311,206 / 311,212] | This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.L65.10. |
5 | T-Box | n/a | gtgtta | [311,228 / 311,234] | This is one of the 6 Brachyury binding sites located in the notochord-active enhancer of KH.L65.10. |
6 | Fox | n/a | gtaaata | [311,239 / 311,246] | This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.L65.10. Deletion of this Fox BS does not affect enhancer activity in the notochord. |
Aniseed Coordinates: [311,070 / 311,303] on scaffold KhL65
The second brachyury binding site is mutated : GTGTTA replaced by GTGGGC. This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.d and TableS5 of Jose-Edwards et al. 2015.
gatatctcgtgtgtgtctggtacatctcaatttaacagcctcgacaccaacgccttacat
gcgtttgtaagttcgcttcgcaacctatttaacaaaccggtgtaaatataacatctgtag
gtgGGCtatttagagtcacatggcggcgtacacgcctggtgttattttggtaaataaaac
ttaacgtttcaagcaaaaggtaaactgtagaatatagtaggttggggtaagtcg