Login
Help

CIS-REGULATION

Submit your Data

  1. Region 'REG00001251'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C9:5648367-5648505_Fox1/Bra4mut|DDR1; DDR2; MUSK

Short name

DDR1/2_CRM24_139pb_Fox1/Bra4mut

Region ID

REG00001251

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2017-09-09)

Annotator

Marion Gueroult-Bellone (2017-09-09)

Curator

Marion Gueroult-Bellone (2018-05-09)


Description

Notochord activity of DDR1/2 139pb enhancer is strongly decreased by the mutation of the first Fox site and the fourth Brachyury site. Activity is also observed in mesenchyme and tail muscles

Regulated gene(s)

KH2012:KH.C9.371 (DDR1; DDR2)

Overview of functional TF binding sites in this region

5,648,3675,648,505

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 T-Box n/a tctcac [5,648,369 / 5,648,375] First Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
2 T-Box n/a gtgaca [5,648,387 / 5,648,393] Second Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
3 T-Box n/a gtgtga [5,648,400 / 5,648,406] Third Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
4 Fox n/a ataaata [5,648,441 / 5,648,448] Second Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
5 Fox n/a ataaaca [5,648,445 / 5,648,452] Third Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
6 Fox n/a acaaata [5,648,449 / 5,648,456] Fourth Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of the three other three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
7 Helix Turn Helix / Tryptophane clusters n/a attgaa [5,648,477 / 5,648,483] This Myb#2 binding site is located in the notochord-active enhancer of KH.C9.371.
8 ZnF_(C2H2) n/a ccacc [5,648,492 / 5,648,497] Sp1/Klf binding site located next to the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer.

Sequence

Aniseed Coordinates: [5,648,367 / 5,648,505] on scaffold KhC9

The first Fox site and the fourth Brachyury site are mutated. Fox1 : TATTTAC replaced by TGGGCAG Bra4 : GTGTAA replaced by TAATAA

Show sequence

Length: 139


aatctcacttacttgcgaaggtgacatcacccggtgtgacggatctcaaaccaggtttgg
gcagttcctcgttaataaataaacaaatacagatcgcaaggctttgtcatattgaactct
gaaagccaccgctgttgcg