- Clone 'ciem845i03' >
- Clone 'cicl043e19' >
- Clone 'cima019b09' >
- Transcript 'Cisavi.CG.ENS81.R0.2...' >
- Region 'REG00001250'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C9:5648367-5648505_allBraMut|DDR1; DDR2; MUSK
Short name
DDR1/2_CRM24_139pb_allBraMut
Region ID
REG00001250
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2017-09-09)
Annotator
Marion Gueroult-Bellone (2017-09-09)
Curator
Marion Gueroult-Bellone (2018-05-09)
Notochord activity of DDR1/2 139pb enhancer is strongly reduced by the mutation of all four brachyury sites.
Modification of Cirobu.REG.KH2012.C9:5648367-5648505|DDR1; DDR2; MUSK by substitution
- Cirobu.REG.KH2012.C9:5648367-5650489|DDR1; DDR2; MUSK REG00001242 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C9:5648367-5649375|DDR1; DDR2; MUSK REG00001243 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C9:5648755-5649375|DDR1; DDR2; MUSK REG00001245 [ no_output ]
- Cirobu.REG.KH2012.C9:5648367-5648757|DDR1; DDR2; MUSK REG00001246 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505|DDR1; DDR2; MUSK REG00001247 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Fox1mut|DDR1; DDR2; MUSK REG00001248 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Bra4mut|DDR1; DDR2; MUSK REG00001249 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_allBraMut|DDR1; DDR2; MUSK REG00001250 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Fox1/Bra4mut|DDR1; DDR2; MUSK REG00001251 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Fox1-3/Bra4mut|DDR1; DDR2; MUSK REG00001252 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505|DDR1; DDR2; MUSK REG00001247 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5649375-5650489|DDR1; DDR2; MUSK REG00001244 [ no_output ]
- Cirobu.REG.KH2012.C9:5648367-5649375|DDR1; DDR2; MUSK REG00001243 [ regulatory_region (extended_promoter) ]
CONS00001253: p.Cirobu.REG.KH2012.C9:5648367-5648505_allBraMut>LacZ
5,648,3675,648,505
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Fox | n/a | tatttac | [5,648,424 / 5,648,431] | First Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of this site alone does not affect enhancer activity in the notochord, but creates new activity in central nervous system and tail muscle. Mutation of this site and of the fourth Brachyury site strongly reduces enhancer activity in the notochord. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
2 | Fox | n/a | ataaata | [5,648,441 / 5,648,448] | Second Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
3 | Fox | n/a | ataaaca | [5,648,445 / 5,648,452] | Third Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
4 | Fox | n/a | acaaata | [5,648,449 / 5,648,456] | Fourth Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of the three other three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
5 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [5,648,477 / 5,648,483] | This Myb#2 binding site is located in the notochord-active enhancer of KH.C9.371. |
6 | ZnF_(C2H2) | n/a | ccacc | [5,648,492 / 5,648,497] | Sp1/Klf binding site located next to the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. |
Aniseed Coordinates: [5,648,367 / 5,648,505] on scaffold KhC9
All four Brachyury binding sites are mutated : Bra1 and 2 : TSTCAC replaced by TSTACA Bra3 : TCACAC replaced by TCAAGA Bra4 : TTACAC replaced by TTATTA
aatctacattacttgcgaagtgtacatcacccgtcttgacggatctcaaaccaggtttat
ttacttcctcgttaataaataaacaaatacagatcgcaaggctttgtcatattgaactct
gaaagccaccgctgttgcg