Login
Help

CIS-REGULATION

Submit your Data

  1. Region 'REG00000465' > 
  2. Clone 'cima022i18' > 
  3. Region 'REG00000709' > 
  4. Transcript 'KH2012:KH.C4.401.v3....' > 
  5. Region 'REG00001250'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C9:5648367-5648505_allBraMut|DDR1; DDR2; MUSK

Short name

DDR1/2_CRM24_139pb_allBraMut

Region ID

REG00001250

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2017-09-09)

Annotator

Marion Gueroult-Bellone (2017-09-09)

Curator

Marion Gueroult-Bellone (2018-05-09)

View position in WashU

Description

Notochord activity of DDR1/2 139pb enhancer is strongly reduced by the mutation of all four brachyury sites.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.C9:5648367-5648505|DDR1; DDR2; MUSK by substitution

Regulated gene(s)

KH2012:KH.C9.371 (DDR1; DDR2)

Construct(s) made to test this region

CONS00001253: p.Cirobu.REG.KH2012.C9:5648367-5648505_allBraMut>LacZ

Show in situ data
Overview of functional TF binding sites in this region

5,648,3675,648,505

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Fox n/a tatttac [5,648,424 / 5,648,431] First Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of this site alone does not affect enhancer activity in the notochord, but creates new activity in central nervous system and tail muscle. Mutation of this site and of the fourth Brachyury site strongly reduces enhancer activity in the notochord. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
2 Fox n/a ataaata [5,648,441 / 5,648,448] Second Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
3 Fox n/a ataaaca [5,648,445 / 5,648,452] Third Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
4 Fox n/a acaaata [5,648,449 / 5,648,456] Fourth Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of the three other three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
5 Helix Turn Helix / Tryptophane clusters n/a attgaa [5,648,477 / 5,648,483] This Myb#2 binding site is located in the notochord-active enhancer of KH.C9.371.
6 ZnF_(C2H2) n/a ccacc [5,648,492 / 5,648,497] Sp1/Klf binding site located next to the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer.

Sequence

Aniseed Coordinates: [5,648,367 / 5,648,505] on scaffold KhC9

All four Brachyury binding sites are mutated : Bra1 and 2 : TSTCAC replaced by TSTACA Bra3 : TCACAC replaced by TCAAGA Bra4 : TTACAC replaced by TTATTA

Show sequence

Length: 139


aatctacattacttgcgaagtgtacatcacccgtcttgacggatctcaaaccaggtttat
ttacttcctcgttaataaataaacaaatacagatcgcaaggctttgtcatattgaactct
gaaagccaccgctgttgcg

Reference(s)

José-Edwards et al. (2015). Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord. PLoS Genet. 11(12):e1005730

Back to Top