Login
Help

CIS-REGULATION

Submit your Data

  1. Transcript 'Boschl.CG.Botznik201...'
  2. Transcript 'Moocci.CG.ELv1_2.S57...'
  3. Region 'REG00001248'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C9:5648367-5648505_Fox1mut|DDR1; DDR2; MUSK

Short name

DDR1/2_CRM24_139pb_Fox1mut

Region ID

REG00001248

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2017-09-09)

Annotator

Marion Gueroult-Bellone (2017-09-09)

Curator

Marion Gueroult-Bellone (2018-05-09)


Description

Notochord activity of DDR1/2 139pb enhancer is not affected by the mutation of the first Fox site. Activity is also observed in tail muscles and central nervous system.

Regulated gene(s)

KH2012:KH.C9.371 (DDR1; DDR2)

Overview of functional TF binding sites in this region

5,648,3675,648,505

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 T-Box n/a tctcac [5,648,369 / 5,648,375] First Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer.
2 T-Box n/a gtgaca [5,648,387 / 5,648,393] Second Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
3 T-Box n/a gtgtga [5,648,400 / 5,648,406] Third Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
4 T-Box n/a gtgtaa [5,648,439 / 5,648,445] Fourth Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of this site alone does not affect enhancer activity in the notochord, but creates new mesenchyme activity. Mutation of this site and of the first Fox site strongly reduces enhancer activity in the notochord. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
5 Fox n/a gtaaata [5,648,441 / 5,648,448] Second Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
6 Fox n/a ataaaca [5,648,445 / 5,648,452] Third Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
7 Fox n/a acaaata [5,648,449 / 5,648,456] Fourth Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of the three other three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
8 Helix Turn Helix / Tryptophane clusters n/a attgaa [5,648,477 / 5,648,483] This Myb#2 binding site is located in the notochord-active enhancer of KH.C9.371.
9 ZnF_(C2H2) n/a ccacc [5,648,492 / 5,648,497] Sp1/Klf binding site located next to the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer.

Sequence

Aniseed Coordinates: [5,648,367 / 5,648,505] on scaffold KhC9

The first Fox binding site is mutated : TATTTAC is replaced by TGGGCAG

Show sequence

Length: 139


aatctcacttacttgcgaaggtgacatcacccggtgtgacggatctcaaaccaggtttgg
gcagttcctcgtgtgtaaataaacaaatacagatcgcaaggctttgtcatattgaactct
gaaagccaccgctgttgcg