- Transcript 'Moocci.CG.ELv1_2.S91...' >
- Transcript 'KH2012:KH.C1.1032.v1...' >
- Transcript 'Moocul.CG.ELv1_2.S28...' >
- Region 'REG00001246'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C9:5648367-5648757|DDR1; DDR2; MUSK
Short name
DDR1/2_CRM24_391pb
Region ID
REG00001246
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2017-09-09)
Annotator
Marion Gueroult-Bellone (2017-09-09)
Curator
Marion Gueroult-Bellone (2018-05-09)
This 391pb region, located upstream of DDR1/DDR2/MUSK (KH.C9.371), drives reporter gene expression in notochord. It contains a cluster of Fox and Brachyury putative binding sites.
Modification of Cirobu.REG.KH2012.C9:5648367-5649375|DDR1; DDR2; MUSK by deletion
- Cirobu.REG.KH2012.C9:5648367-5650489|DDR1; DDR2; MUSK REG00001242 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C9:5648367-5649375|DDR1; DDR2; MUSK REG00001243 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C9:5648755-5649375|DDR1; DDR2; MUSK REG00001245 [ no_output ]
- Cirobu.REG.KH2012.C9:5648367-5648757|DDR1; DDR2; MUSK REG00001246 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505|DDR1; DDR2; MUSK REG00001247 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Fox1mut|DDR1; DDR2; MUSK REG00001248 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Bra4mut|DDR1; DDR2; MUSK REG00001249 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_allBraMut|DDR1; DDR2; MUSK REG00001250 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Fox1/Bra4mut|DDR1; DDR2; MUSK REG00001251 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505_Fox1-3/Bra4mut|DDR1; DDR2; MUSK REG00001252 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5648367-5648505|DDR1; DDR2; MUSK REG00001247 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C9:5649375-5650489|DDR1; DDR2; MUSK REG00001244 [ no_output ]
- Cirobu.REG.KH2012.C9:5648367-5649375|DDR1; DDR2; MUSK REG00001243 [ regulatory_region (extended_promoter) ]
5,648,3675,648,757
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | T-Box | n/a | tctcac | [5,648,369 / 5,648,375] | First Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. |
2 | T-Box | n/a | gtgaca | [5,648,387 / 5,648,393] | Second Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord. |
3 | T-Box | n/a | gtgtga | [5,648,400 / 5,648,406] | Third Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord. |
4 | Fox | n/a | tatttac | [5,648,424 / 5,648,431] | First Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of this site alone does not affect enhancer activity in the notochord, but creates new activity in central nervous system and tail muscle. Mutation of this site and of the fourth Brachyury site strongly reduces enhancer activity in the notochord. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
5 | T-Box | n/a | gtgtaa | [5,648,439 / 5,648,445] | Fourth Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of this site alone does not affect enhancer activity in the notochord, but creates new mesenchyme activity. Mutation of this site and of the first Fox site strongly reduces enhancer activity in the notochord. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord. |
6 | Fox | n/a | gtaaata | [5,648,441 / 5,648,448] | Second Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
7 | Fox | n/a | ataaaca | [5,648,445 / 5,648,452] | Third Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
8 | Fox | n/a | acaaata | [5,648,449 / 5,648,456] | Fourth Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of the three other three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord. |
9 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [5,648,477 / 5,648,483] | This Myb#2 binding site is located in the notochord-active enhancer of KH.C9.371. |
10 | ZnF_(C2H2) | n/a | ccacc | [5,648,492 / 5,648,497] | Sp1/Klf binding site located next to the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. |
Aniseed Coordinates: [5,648,367 / 5,648,757] on scaffold KhC9
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS2.a and TableS5 of Jose-Edwards et al. 2015.
aatctcacttacttgcgaaggtgacatcacccggtgtgacggatctcaaaccaggtttat
ttacttcctcgtgtgtaaataaacaaatacagatcgcaaggctttgtcatattgaactct
gaaagccaccgctgttgcgccaataacagggaccataaccggcacaactaccagtacaaa
gttgcatgaaacaatatcgacagtttcaatacaaacaaattatcatagttttatgcaaac
atttgttcaagcgacgtattatccaaacatagaaaaaatacatttcttttcaaagaagtc
attgtgaaaaaatcctatgaaatggttgtatacccacttttaaattcgtcataccaagtt
caaacaaaagaacaaaaatagcgattacgta