- Region 'REG00001216'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C6:403548-403985|Onecut_HNF6
Short name
Onecut/HNF6 (-881/-444)
Region ID
REG00001216
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(extended_promoter)
Author
Maria Rosa Pezzotti (2017-08-06)
Annotator
Marion Gueroult-Bellone (2017-08-06)
Curator
Delphine Dauga (2017-09-06)
This sequence derives from the 1.38kb cis-regulatory sequence of Onecut/HNF6 (REG00001214) active in the sensory vesicle, the visceral ganglion, the tail and ectopic mesenchyme in Ciona intestinalis tailbuds and larvae. It is slighlty weaker in all these domains, except in the tail where the deletion strongly reduces its activity.
Modification of Cirobu.REG.KH2012.C6:403105-404485|Onecut_HNF6 by deletion
- Cirobu.REG.KH2012.C6:403105-405698|Onecut_HNF6 REG00001211 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C6:404848-405698|Onecut_HNF6 REG00001212 [ inactive_region ]
- Cirobu.REG.KH2012.C6:404401-404922|Onecut_HNF6 REG00001213 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403105-404485|Onecut_HNF6 REG00001214 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C6:403974-404485|Onecut_HNF6 REG00001215 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C6:403548-403985|Onecut_HNF6 REG00001216 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C6:403105-403572|Onecut_HNF6 REG00001217 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C6:403733-404043|Onecut_HNF6 REG00001218 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043|Onecut_HNF6 REG00001223 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.C6:403839-404043|Onecut_HNF6 REG00001224 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-403940|Onecut_HNF6 REG00001228 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043(µ_Ngn)|Onecut_HNF6 REG00001229 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043(µ_OCa)|Onecut_HNF6 REG00001230 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043(µ_OCb)|Onecut_HNF6 REG00001231 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043(µ_Ngn-OCa)|Onecut_HNF6 REG00001232 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043(µ_Ngn-OCb)|Onecut_HNF6 REG00001233 [ inactive_region ]
- Cirobu.REG.KH2012.C6:403782-404043(µ_OCa-OCb)|Onecut_HNF6 REG00001234 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043(µ_Ngn-OCa-OCb)|Onecut_HNF6 REG00001235 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403733-403838|Onecut_HNF6 REG00001225 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C6:403782-404043|Onecut_HNF6 REG00001223 [ regulatory_region (extended_promoter) ]
403,548403,985
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Homeobox | n/a | tataattgaatattttt | [403,797 / 403,814] | This Onecut/HNF6 binding site is one of the three identified binding sites of HNF6/Onecut minimal enhancer (the others are a Neurogenin and another HNF6/Onecut sites). It is located at -705/-689pb from HNF6/Onecut TSS. The mutational analysis not only indicates that all the three identified binding sites (Ngn, OCa and OCb) are necessary for Onecut activation in its endogenous territories but also that a cooperation between the two OC sites for the maintenance of its expression exists. |
2 | Homeobox | n/a | aattgtagattgtttga | [403,838 / 403,855] | This Onecut/HNF6 binding site is one of the three identified binding sites of HNF6/Onecut minimal enhancer (the others are a Neurogenin and another HNF6/Onecut sites). It is located at -746/-730pb from HNF6/Onecut TSS. The mutational analysis not only indicates that all the three identified binding sites (Ngn, OCa and OCb) are necessary for Onecut activation in its endogenous territories but also that a cooperation between the two OC sites for the maintenance of its expression exists. |
3 | bHLH | n/a | gggccatctgctg | [403,943 / 403,956] | This Neurogenin binding site is one of the three identified binding sites of HNF6/Onecut minimal enhancer (the others are two HNF6/Onecut sites). It is located at -847/-835pb from HNF6/Onecut TSS. At neurula stage, Neurogenin is necessary for enhancer activation in the Onecut territories. Then, neurogenin seems to be the activator only in the visceral ganglion up to larva stage. |
Aniseed Coordinates: [403,548 / 403,985] on scaffold KhC6
This fragment extending from the position 881 to 444 upstream of the translation start site was PCR-amplified from the 2.6kb Onecut/HNF6 enhancer (REG00001211).
acaacgaactccgaagaattcaacgtcgccatttatttacgatcatgcatgtcgctgcgt
atacttatatgctggttatgcacgtaccttttataaagtatatataaaattacttttatt
tagttatatagtcgaaaaaatattatcaaaaatattctttttttcgaaaatattttaatt
tctctcttgcgctatgcgaacttgaatcttagaaactgtaattaggcctccaaactgact
aaactgttttataattgaatatttttctttccaaggcttgaacttgtcttaattgtagat
tgtttgaatttaaacaaattttcgatcagtcctttacggttgagctccaagctcgaatgg
aagactggtgccgtactcgtatgggagtaagcaatgggccatctgctgcgtttttctgtt
cggcttatatacgagtgg