Description

We identified a minimal FoxC enhancer by making 5prime and 3prime deletions of the original 2 kb fragment, to facilitate analysis of potential transcription factor binding sites. We isolated a 325 bp fragment that maps from minus 375 to minus 50 bp relative to the start codon. It contains two putative ETS binding sites (GGAA/T) located at 255 bp and 295 bp upstream the start codon.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.L57:96056-98200|FoxC by deletion

Regulated gene(s)

KH2012:KH.L57.25 (FOXC1; FOXC2; FOXL1)

Construct(s) made to test this region

CONS00001192: p.Cirobu.REG.KH2012.L57:97812-98149>H2B:mCherry

CONS00001194: p.Cirobu.REG.KH2012.L57:97812-98149>H2B:CFP

CONS00001193: p.Cirobu.REG.KH2012.L57:97812-98149>YFP-caax

CONS00001188: p.Cirobu.REG.KH2012.L57:97812-98149>LacZ

CONS00001195: p.Cirobu.REG.KH2012.L57:97812-98149>GFP-caax

Overview of functional TF binding sites in this region

97,81298,149

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment

Sequence

Aniseed Coordinates: [97,812 / 98,149] on scaffold KhL57

The minimal FoxC enhancer was amplified with FoxC-375XhF (5prime-GAAACTCGAGCAGGTGTTTCGTAAGGCGGC) and FoxC 50 BR (5prime- TAATGGATCCAACTTACACTAACACTGCCCG)

Reference(s)

Wagner et al. (2012). FGF signaling establishes the anterior border of the Ciona neural tube. Development 139(13):2351-9

Wagner et al. (2014). Islet is a key determinant of ascidian palp morphogenesis. Development 141(15):3084-92