- Region 'REG00000146' >
- Transcript 'Moocul.CG.ELv1_2.S27...' >
- Transcript 'KH2012:KH.C5.25.v1.A...' >
- Region 'REG00000896'
Cis-regulatory Region
Name
Ci-Pitx -323/-163
Short name
n/a
Region ID
REG00000896
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Yoshida Keita (2011-08-10)
Annotator
Marion Gueroult-Bellone (2011-08-10)
Curator
Delphine Dauga (2011-08-10)
The region from -3853 bp upstream the +1 to 147 pb downstream is an extended promoter which drives Ci-Pitxc expression.
This region contains one essential cis-regulatory elements.
Region -323 bp/-163 bp : it contains one Fox binding site. Removal of this site drives no expression in the epidermis.
Modification of Ci-Pitx -553/147 by deletion
- Ci-Pitx -7865/140 REG00000681 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -2735/-2540 REG00000682 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 First Otx site mutated REG00000685 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 Second Otx site mutated REG00000686 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 First Forkhead site mutated REG00000687 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 Second Forkhead site mutated REG00000688 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 First Smad site mutated REG00000689 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 Second, Third, Fourth Smad site mutated REG00000690 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 TALE-class sites mutated REG00000691 [ regulatory_region (enhancer) ]
- Ci-Pitx -2751/-2543 delta -2693/-2646 delta -2606/-2588 REG00000684 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2606 delta -2693/-2646 REG00000692 [ inactive_region ]
- Ci-Pitx -2751/-2696 REG00000693 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 REG00000694 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2696 repeated x2 Second Pax site deleted REG00000696 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 Second Otx site mutated REG00000697 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 Second Forkhead site mutated REG00000698 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 Second Smad site mutated REG00000699 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2/25bp spacer REG00000700 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2696 repeated x2/50bp spacer REG00000701 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2/75bp spacer REG00000702 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2/150bp spacer REG00000703 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x5 REG00000695 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2606 delta -2693/-2646 REG00000692 [ inactive_region ]
- Ci-Pitx -5500/56 REG00000874 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -5500/-1328 REG00000875 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2540 REG00000873 [ regulatory_region (enhancer) ]
- REG00000876 [ regulatory_region (complex_region) ]
- REG00000877 [ regulatory_region (complex_region) ]
- Ci-Pitx -3815/55 REG00000878 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3164/56 REG00000879 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3429/-2250 REG00000888 [ regulatory_region (complex_region) ]
- Ci-Pitx -5500/-1328 REG00000875 [ regulatory_region (complex_region) ]
- Ci-Pitx -2760/140 REG00000885 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3853/147 REG00000891 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3853/-553 REG00000892 [ regulatory_region (enhancer) ]
- Ci-Pitx -553/147 REG00000893 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KhL153:204692-208149|Pitx REG00001523 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 REG00000682 [ regulatory_region (enhancer) ]
00
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment |
---|
Aniseed Coordinates: [0 / 0] on scaffold
The sequence was based on JGI V1.0. The nucleotide +1 taken in reference corresponds to the first codon.
TGGAATTTTAGATTGTTAATCCTATTTCGCGTCTACTATTTCATTATATACCATACGCGT
TGTCACCTGTGTGACGTCATAATACGGAATTGTTCATTTATCATAGAAAAAACTGTCACG
AATTTTTATTATCATTTAAAAACAAATATTATTTGACAGC