- Region 'REG00000119'
Cis-regulatory Region
Name
pBra
Short name
n/a
Region ID
REG00000119
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(RNApol_II_core_promoter)
Author
Joseph C. Corbo (2006-10-01)
Annotator
Clara Degos (2010-07-22)
Curator
Delphine Dauga (2008-04-04)
Region from -483 bp upstream the +1 to the first 17 codons is the minimal enhancer which drives the entire Ci-Bra expression (the transcription start site is the nucleotide +1).
This region contains three essential cis-regulatory elements.
Region - 483 bp/- 348 bp : negative response that keeps the enhancer off in ectopic mesodermal lineage (muscles and mesenchyme). This region contains three copies of a conserved 15 bp sequence motif. It is currently unclear whether this repeat is important for repression.
Region -348 bp/ - 237 bp : it contains one, or possibly two, Su(H) binding sites. Removal of these sites significantly decreases expression in the notochord.
Region - 237 bp/- 71 bp : it contains important element for activation in the mesenchyme and muscles. This region contains three E-box sequences. Progressive truncations that remove these sequences lead to a sequential loss of expression in ectopic mesodermal lineage.
Modification of Ci-Bra -143/17 first codons by deletion
- Ci-Bra -3500/17 first codons REG00000092 [ regulatory_region (extended_promoter) ]
- Ci-Bra -3500/17 first codons 2ZicL mutated REG00000093 [ regulatory_region (extended_promoter) ]
- Ci-Bra -3500/17 first codons ZicLb1 mutated REG00000094 [ regulatory_region (extended_promoter) ]
- Ci-Bra -3500/17 first codons ZicLb2 mutated REG00000095 [ regulatory_region (extended_promoter) ]
- Ci-Bra -839/-49 REG00000399 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons REG00000096 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/codon 17 Sna2 mutated REG00000097 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons 2Su(H) mutated REG00000098 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons 2ZicL mutated REG00000099 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons Spacer Sna1/Su(H)1 REG00000100 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons Spacer Su(H)2/Sna2 REG00000101 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons ZicLb1 mutated REG00000102 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons ZicLb2 mutated REG00000103 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons delta Sna1 REG00000104 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons delta Sna2 REG00000105 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons delta 2Su(H) REG00000106 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons delta -405/-346 REG00000107 [ no_output ]
- Ci-Bra -363/17 first codons REG00000115 [ regulatory_region (extended_promoter) ]
- Ci-Bra -324/17 first codons REG00000397 [ regulatory_region (extended_promoter) ]
- Ci-Bra -300/17 first codons REG00000112 [ regulatory_region (extended_promoter) ]
- Ci-Bra -300/17 first codons Sna added REG00000113 [ regulatory_region (extended_promoter) ]
- Ci-Bra -300/17 first codons Su(H)1 mutated REG00000114 [ regulatory_region (extended_promoter) ]
- Ci-Bra -299/17 first codons REG00000396 [ regulatory_region (extended_promoter) ]
- Ci-Bra -300/17 first codons REG00000112 [ regulatory_region (extended_promoter) ]
- Ci-Bra -324/17 first codons REG00000397 [ regulatory_region (extended_promoter) ]
- Ci-Bra -483/17 first codons REG00000096 [ regulatory_region (extended_promoter) ]
- Ci-Bra -839/-49 REG00000399 [ regulatory_region (extended_promoter) ]
- Ci-Bra -890bp/-1bp REG00000189 [ regulatory_region (extended_promoter) ]
6,2006,292
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment |
---|
Aniseed Coordinates: [6,200 / 6,292] on scaffold KhS1404
This sequence was found using a blast on the JGI V1.0 using sequences included in Corbo et al. (1997 and 1998), Fujiwara et al. (1998) and Yagi et al (2004). The basal promoter of Ci-Bra (-68 to +26) was cloned between the Pst1 and BamH1 sites of the p72-1.27 vector: Pst1 - pBra(-68/+26) - BamH1
AAGTTATGACGTCACAATCCTGTATAAACTTGCACCCGAGTGTGATTTGGAGGCAGAATG
TTTTCGAAGCTCAGTGCGAGTTACAAACCTATA