A 3.8 kb region located upstream of the gene contains all the regulatory elements able to reproduce its spatial expression pattern. Analyzing progressively truncated fragments of this region; three discrete and separate regions driving LacZ reporter gene expression in the ventral epidermis, primordial pharynx and neural territories have been identified :


- Region - 2546 bp/- 818 bp : Drives the expression in the ventral epidermis


- Region -457 bp/ - 227 bp : Drives the expression in the pharynx


- Region - 227 bp/- 84 bp : Drives the expression in the visceral ganglion, the sensory vesicle, the otolith-ocellus precursor and in the neural tube.


Be careful, coordinates in the paper are different from ANISEED coordinates. We took the KH transcript model as reference.

Coordinates in the paper : 119bp/227bp

Modification of Ci-msxb 130/238 by insertion

KH2012:KH.C2.957 (DLX1; MSX1; MSX2)

CONS00000073: pMsxb 130bp/238bp N3 added::LacZ

5,773,6435,773,750

Aniseed Coordinates: [5,773,643 / 5,773,750] on scaffold KhC2

This sequence was found using blast on the JGI version 1.0 with the sequence found in the paper. Two motifs N3 (atcgtcgcggccgaagcgtgaccaagtcgt) was fused to the +119bp/+227bp Ci-msxb enhancer sequence.

Russo et al. (2004). Regulatory elements controlling Ci-msxb tissue-specific expression during Ciona intestinalis embryonic development. Dev. Biol. 267(2):517-28